Quick Order

Human ARHI / DIRAS3 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human DIRAS3 cDNA Clone Product Information
    NCBI RefSeq:BC005362
    RefSeq ORF Size:690bp
    cDNA Description:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
    Gene Synonym:ARHI, NOEY2, DIRAS3
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIRAS3 qPCR primers for gene expression analysis, HP102889 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

    References
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"