DHRS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16356-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DHRS4 Reagents
CRO Services
Product recommended

All DHRS4 Reagents
DHRS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Human dehydrogenase/reductase (SDR family) member 4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DHRS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CR cDNA ORF Clone, Human;NRDR cDNA ORF Clone, Human;PHCR cDNA ORF Clone, Human;PSCD cDNA ORF Clone, Human;SCAD-SRL cDNA ORF Clone, Human;SDR-SRL cDNA ORF Clone, Human;SDR25C1 cDNA ORF Clone, Human;SDR25C2 cDNA ORF Clone, Human
DHRS4 Background Information
Full Name
dehydrogenase/reductase (SDR family) member 4

DHRS4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DHRS4 cDNA ORF Clone in Cloning Vector, Rat RG87504-U
DHRS4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87504-ACGLN

DHRS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DHRS4 cDNA ORF Clone in Cloning Vector, Mouse MG51195-U
DHRS4 cDNA ORF Clone, Mouse, untagged MG51195-UT
DHRS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51195-ACGLN
DHRS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51195-ACG
DHRS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51195-ANG
DHRS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51195-ACR
DHRS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51195-ANR
DHRS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51195-CF
DHRS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51195-NF
DHRS4 cDNA ORF Clone, Mouse, C-His tag MG51195-CH
DHRS4 cDNA ORF Clone, Mouse, N-His tag MG51195-NH
DHRS4 cDNA ORF Clone, Mouse, C-HA tag MG51195-CY
DHRS4 cDNA ORF Clone, Mouse, N-HA tag MG51195-NY
DHRS4 cDNA ORF Clone, Mouse, C-Myc tag MG51195-CM
DHRS4 cDNA ORF Clone, Mouse, N-Myc tag MG51195-NM
DHRS4 qPCR Primer Pairs, Mouse MP201079

DHRS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DHRS4 cDNA ORF Clone in Cloning Vector, Human HG16356-G
DHRS4 cDNA ORF Clone, Human, untagged HG16356-UT
DHRS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16356-ACGLN
DHRS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16356-ACG
DHRS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16356-ANG
DHRS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16356-ACR
DHRS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16356-ANR
DHRS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16356-CF
DHRS4 cDNA ORF Clone, Human, C-His tag HG16356-CH
DHRS4 cDNA ORF Clone, Human, N-His tag HG16356-NH
DHRS4 cDNA ORF Clone, Human, C-HA tag HG16356-CY
DHRS4 cDNA ORF Clone, Human, N-HA tag HG16356-NY
DHRS4 cDNA ORF Clone, Human, C-Myc tag HG16356-CM
DHRS4 cDNA ORF Clone, Human, N-Myc tag HG16356-NM
DHRS4 qPCR Primer Pairs, Human HP105108
info info
添加购物车成功! 添加购物车失败!