DGAT2 cDNA ORF Clone, Human, C-His tag

Cat: HG14114-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DGAT2 Reagents
CRO Services
Product recommended

All DGAT2 Reagents
DGAT2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1167 bp
Description
Full length Clone DNA of Human diacylglycerol O-acyltransferase 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DGAT2 cDNA ORF Clone, Human, C-His tag Alternative Names
ARAT cDNA ORF Clone, Human;GS1999FULL cDNA ORF Clone, Human;HMFN1045 cDNA ORF Clone, Human
DGAT2 Background Information
Full Name
diacylglycerol O-acyltransferase 2

DGAT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DGAT2 cDNA ORF Clone in Cloning Vector, Mouse MG58866-U
DGAT2 cDNA ORF Clone, Mouse, untagged MG58866-UT
DGAT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58866-ACGLN
DGAT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58866-ACG
DGAT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58866-ANG
DGAT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58866-ACR
DGAT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58866-ANR
DGAT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58866-CF
DGAT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58866-NF
DGAT2 cDNA ORF Clone, Mouse, C-His tag MG58866-CH
DGAT2 cDNA ORF Clone, Mouse, N-His tag MG58866-NH
DGAT2 cDNA ORF Clone, Mouse, C-HA tag MG58866-CY
DGAT2 cDNA ORF Clone, Mouse, N-HA tag MG58866-NY
DGAT2 cDNA ORF Clone, Mouse, C-Myc tag MG58866-CM
DGAT2 cDNA ORF Clone, Mouse, N-Myc tag MG58866-NM

DGAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DGAT2 cDNA ORF Clone in Cloning Vector, Human HG14114-G
DGAT2 cDNA ORF Clone, Human, untagged HG14114-UT
DGAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14114-ACG
DGAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14114-ACGLN
DGAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14114-ACR
DGAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14114-CF
DGAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14114-NF
DGAT2 cDNA ORF Clone, Human, N-His tag HG14114-NH
DGAT2 cDNA ORF Clone, Human, C-HA tag HG14114-CY
DGAT2 cDNA ORF Clone, Human, N-HA tag HG14114-NY
DGAT2 cDNA ORF Clone, Human, C-Myc tag HG14114-CM
DGAT2 cDNA ORF Clone, Human, N-Myc tag HG14114-NM
DGAT2 qPCR Primer Pairs, Human HP102767
info info
添加购物车成功! 添加购物车失败!