Desmin cDNA ORF Clone, Human, N-Myc tag

Cat: HG13865-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Desmin Reagents
CRO Services
Product recommended

All Desmin Reagents
Desmin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Human desmin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Desmin cDNA ORF Clone, Human, N-Myc tag Alternative Names
CSM1 cDNA ORF Clone, Human;CSM2 cDNA ORF Clone, Human;LGMD2R cDNA ORF Clone, Human
Desmin Background Information
Full Name
desmin

Desmin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Rat RG81599-G
Desmin cDNA ORF Clone, Rat, untagged RG81599-UT
Desmin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81599-ACG
Desmin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81599-ACGLN
Desmin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81599-ANG
Desmin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81599-ACR
Desmin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81599-ANR
Desmin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81599-CF
Desmin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81599-NF
Desmin cDNA ORF Clone, Rat, C-His tag RG81599-CH
Desmin cDNA ORF Clone, Rat, N-His tag RG81599-NH
Desmin cDNA ORF Clone, Rat, C-HA tag RG81599-CY
Desmin cDNA ORF Clone, Rat, N-HA tag RG81599-NY
Desmin cDNA ORF Clone, Rat, C-Myc tag RG81599-CM
Desmin cDNA ORF Clone, Rat, N-Myc tag RG81599-NM

Desmin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Mouse MG57000-U
Desmin cDNA ORF Clone, Mouse, untagged MG57000-UT
Desmin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57000-ACG
Desmin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57000-ACGLN
Desmin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57000-ANG
Desmin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57000-ACR
Desmin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57000-ANR
Desmin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57000-CF
Desmin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57000-NF
Desmin cDNA ORF Clone, Mouse, C-His tag MG57000-CH
Desmin cDNA ORF Clone, Mouse, N-His tag MG57000-NH
Desmin cDNA ORF Clone, Mouse, C-HA tag MG57000-CY
Desmin cDNA ORF Clone, Mouse, N-HA tag MG57000-NY
Desmin cDNA ORF Clone, Mouse, C-Myc tag MG57000-CM
Desmin cDNA ORF Clone, Mouse, N-Myc tag MG57000-NM

Desmin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Desmin cDNA ORF Clone in Cloning Vector, Human HG13865-G
Desmin cDNA ORF Clone, Human, untagged HG13865-UT
Desmin cDNA ORF Clone, Human, C-GFPSpark® tag HG13865-ACG
Desmin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13865-ACGLN
Desmin cDNA ORF Clone, Human, N-GFPSpark® tag HG13865-ANG
Desmin cDNA ORF Clone, Human, C-OFPSpark® tag HG13865-ACR
Desmin cDNA ORF Clone, Human, N-OFPSpark® tag HG13865-ANR
Desmin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13865-CF
Desmin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13865-NF
Desmin cDNA ORF Clone, Human, C-His tag HG13865-CH
Desmin cDNA ORF Clone, Human, N-His tag HG13865-NH
Desmin cDNA ORF Clone, Human, C-HA tag HG13865-CY
Desmin cDNA ORF Clone, Human, N-HA tag HG13865-NY
Desmin cDNA ORF Clone, Human, C-Myc tag HG13865-CM
Desmin qPCR Primer Pairs, Human HP102536
info info
添加购物车成功! 添加购物车失败!