beta Defensin 3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10849-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All beta Defensin 3 Reagents
CRO Services
Product recommended

All beta Defensin 3 Reagents
beta Defensin 3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
204 bp
Description
Full length Clone DNA of Human defensin, beta 103A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta Defensin 3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
BD-3 cDNA ORF Clone, Human;DEFB-3 cDNA ORF Clone, Human;DEFB103 cDNA ORF Clone, Human;DEFB3 cDNA ORF Clone, Human;hBD-3 cDNA ORF Clone, Human;HBD3 cDNA ORF Clone, Human;HBP-3 cDNA ORF Clone, Human;HBP3 cDNA ORF Clone, Human
beta Defensin 3 Background Information

Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and cytotoxic peptides made by neutrophils. Members of the beta-defensin 3 family are highly similar in protein sequence. Beta-defensin 3 shows antimicrobial activity against Gram-positive bacteria S.aureus and S.pyogenes, Gram-negative bacteria P.aeruginosa and E.coli and the yeast C.albicans. Beta-defensin 3 is abundantly expressed in skin and tonsils, and to a lesser extent in trachea, uterus, kidney, thymus, adenoid, pharynx and tongue. It is also expressed in salivary gland, bone marrow, colon, stomach, polyp and larynx. However, in small intestine, it cannot be detected. Defensin has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. Beta-defensin 3 kills multiresistant S.aureus and vancomycin-resistent E.faecium. It has no significant hemolytic activity.

Full Name
defensin, beta 103A
References
  • Garca JR, et al. (2002) Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306(2):257-64.
  • Dunsche A, et al. (2002) The novel human beta-defensin-3 is widely expressed in oral tissues. Eur J Oral Sci. 110(2):121-4.
  • Abiko Y, et al. (2004) Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci. 31(3): 225-8.
  • info info
    添加购物车成功! 添加购物车失败!