Quick Order

Human Defensin / Beta-defensin 3 / DEFB103 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human DEFB103A cDNA Clone Product Information
    NCBI RefSeq:NM_018661.3
    RefSeq ORF Size:204bp
    cDNA Description:Full length Clone DNA of Homo sapiens defensin, beta 103A with N terminal His tag.
    Gene Synonym:DEFB103A
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DEFB103A qPCR primers for gene expression analysis, HP100746 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Human Defensin / Beta-defensin 3 / DEFB103 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
    Product nameProduct name
    Background

    Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and cytotoxic peptides made by neutrophils. Members of the beta-defensin 3 family are highly similar in protein sequence. Beta-defensin 3 shows antimicrobial activity against Gram-positive bacteria S.aureus and S.pyogenes, Gram-negative bacteria P.aeruginosa and E.coli and the yeast C.albicans. Beta-defensin 3 is abundantly expressed in skin and tonsils, and to a lesser extent in trachea, uterus, kidney, thymus, adenoid, pharynx and tongue. It is also expressed in salivary gland, bone marrow, colon, stomach, polyp and larynx. However, in small intestine, it cannot be detected. Defensin has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. Beta-defensin 3 kills multiresistant S.aureus and vancomycin-resistent E.faecium. It has no significant hemolytic activity.

    References
  • Garca JR, et al. (2002) Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306(2):257-64.
  • Dunsche A, et al. (2002) The novel human beta-defensin-3 is widely expressed in oral tissues. Eur J Oral Sci. 110(2):121-4.
  • Abiko Y, et al. (2004) Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci. 31(3): 225-8.
  • Size / Price
    Catalog: HG10849-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"