Quick Order

Text Size:AAA

Human DEFA6 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human DEFA6 cDNA Clone Product Information
NCBI RefSeq:BC069667
RefSeq ORF Size:303bp
cDNA Description:Full length Clone DNA of Homo sapiens defensin, alpha 6, Paneth cell-specific.
Gene Synonym:DEF6, HD-6
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-DEFA6
Restriction Site:KpnI + XbaI (6.1kb + 0.3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DEFA6 Gene Plasmid Map
Human DEFA6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG15328-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human DEFA6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"