DECR2 cDNA ORF Clone, Human, C-His tag

Cat: HG14056-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DECR2 Reagents
CRO Services
Product recommended

All DECR2 Reagents
DECR2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human 2,4-dienoyl CoA reductase 2, peroxisomal with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DECR2 cDNA ORF Clone, Human, C-His tag Alternative Names
PDCR cDNA ORF Clone, Human;SDR17C1 cDNA ORF Clone, Human
DECR2 Background Information
Full Name
2,4-dienoyl CoA reductase 2, peroxisomal

DECR2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
DECR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90752-G
DECR2 cDNA ORF Clone, Rhesus, untagged CG90752-UT
DECR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90752-ACG
DECR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90752-ACGLN
DECR2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90752-ANG
DECR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90752-ACR
DECR2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90752-ANR
DECR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90752-CF
DECR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90752-NF
DECR2 cDNA ORF Clone, Rhesus, C-His tag CG90752-CH
DECR2 cDNA ORF Clone, Rhesus, N-His tag CG90752-NH
DECR2 cDNA ORF Clone, Rhesus, C-HA tag CG90752-CY
DECR2 cDNA ORF Clone, Rhesus, N-HA tag CG90752-NY
DECR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90752-CM
DECR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90752-NM

DECR2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DECR2 cDNA ORF Clone in Cloning Vector, Rat RG80677-U
DECR2 cDNA ORF Clone, Rat, untagged RG80677-UT
DECR2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80677-ACG
DECR2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80677-ACGLN
DECR2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80677-ANG
DECR2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80677-ACR
DECR2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80677-ANR
DECR2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80677-CF
DECR2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80677-NF
DECR2 cDNA ORF Clone, Rat, C-His tag RG80677-CH
DECR2 cDNA ORF Clone, Rat, N-His tag RG80677-NH
DECR2 cDNA ORF Clone, Rat, C-HA tag RG80677-CY
DECR2 cDNA ORF Clone, Rat, N-HA tag RG80677-NY
DECR2 cDNA ORF Clone, Rat, C-Myc tag RG80677-CM
DECR2 cDNA ORF Clone, Rat, N-Myc tag RG80677-NM
DECR2 qPCR Primer Pairs, Rat RP300641

DECR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DECR2 cDNA ORF Clone in Cloning Vector, Human HG14056-G
DECR2 cDNA ORF Clone, Human, untagged HG14056-UT
DECR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14056-ACG
DECR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14056-ACGLN
DECR2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14056-ANG
DECR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14056-ACR
DECR2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14056-ANR
DECR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14056-CF
DECR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14056-NF
DECR2 cDNA ORF Clone, Human, N-His tag HG14056-NH
DECR2 cDNA ORF Clone, Human, C-HA tag HG14056-CY
DECR2 cDNA ORF Clone, Human, N-HA tag HG14056-NY
DECR2 cDNA ORF Clone, Human, C-Myc tag HG14056-CM
DECR2 cDNA ORF Clone, Human, N-Myc tag HG14056-NM
DECR2 qPCR Primer Pairs, Human HP102712
info info
添加购物车成功! 添加购物车失败!