DDX49 cDNA ORF Clone, Human, untagged

Cat: HG16170-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DDX49 Reagents
CRO Services
Product recommended

All DDX49 Reagents
DDX49 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1452 bp
Description
Full length Clone DNA of Human DEAD (Asp-Glu-Ala-Asp) box polypeptide 49.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX49 cDNA ORF Clone, Human, untagged Alternative Names
R27090_2 cDNA ORF Clone, Human
DDX49 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

DDX49 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX49 cDNA ORF Clone in Cloning Vector, Mouse MG52233-G
DDX49 cDNA ORF Clone, Mouse, untagged MG52233-UT
DDX49 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52233-ACG
DDX49 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52233-ACGLN
DDX49 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52233-ANG
DDX49 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52233-ACR
DDX49 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52233-ANR
DDX49 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52233-CF
DDX49 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52233-NF
DDX49 cDNA ORF Clone, Mouse, C-His tag MG52233-CH
DDX49 cDNA ORF Clone, Mouse, N-His tag MG52233-NH
DDX49 cDNA ORF Clone, Mouse, C-HA tag MG52233-CY
DDX49 cDNA ORF Clone, Mouse, N-HA tag MG52233-NY
DDX49 cDNA ORF Clone, Mouse, C-Myc tag MG52233-CM
DDX49 cDNA ORF Clone, Mouse, N-Myc tag MG52233-NM
DDX49 qPCR Primer Pairs, Mouse MP202106

DDX49 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX49 cDNA ORF Clone in Cloning Vector, Human HG16170-G
DDX49 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16170-ACGLN
DDX49 cDNA ORF Clone, Human, C-GFPSpark® tag HG16170-ACG
DDX49 cDNA ORF Clone, Human, N-GFPSpark® tag HG16170-ANG
DDX49 cDNA ORF Clone, Human, C-OFPSpark® tag HG16170-ACR
DDX49 cDNA ORF Clone, Human, N-OFPSpark® tag HG16170-ANR
DDX49 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16170-CF
DDX49 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16170-NF
DDX49 cDNA ORF Clone, Human, C-His tag HG16170-CH
DDX49 cDNA ORF Clone, Human, N-His tag HG16170-NH
DDX49 cDNA ORF Clone, Human, C-HA tag HG16170-CY
DDX49 cDNA ORF Clone, Human, N-HA tag HG16170-NY
DDX49 cDNA ORF Clone, Human, C-Myc tag HG16170-CM
DDX49 cDNA ORF Clone, Human, N-Myc tag HG16170-NM
DDX49 qPCR Primer Pairs, Human HP104939
info info
添加购物车成功! 添加购物车失败!