DDX1 cDNA ORF Clone, Human, N-His tag

Cat: HG14957-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DDX1 Reagents
CRO Services
Product recommended

All DDX1 Reagents
DDX1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2223 bp
Description
Full length Clone DNA of Human DEAD (Asp-Glu-Ala-Asp) box helicase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX1 cDNA ORF Clone, Human, N-His tag Alternative Names
DBP-RB cDNA ORF Clone, Human;UKVH5d cDNA ORF Clone, Human
DDX1 Background Information
Full Name
DEAD (Asp-Glu-Ala-Asp) box helicase 1

DDX1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DDX1 cDNA ORF Clone in Cloning Vector, Rat RG86353-U
DDX1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86353-ACGLN

DDX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX1 cDNA ORF Clone in Cloning Vector, Mouse MG5A1422-U
DDX1 cDNA ORF Clone, Mouse, untagged MG5A1422-UT
DDX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1422-ACGLN
DDX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1422-ACG
DDX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1422-ANG
DDX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1422-ACR
DDX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1422-ANR
DDX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1422-CF
DDX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1422-NF
DDX1 cDNA ORF Clone, Mouse, C-His tag MG5A1422-CH
DDX1 cDNA ORF Clone, Mouse, N-His tag MG5A1422-NH
DDX1 cDNA ORF Clone, Mouse, C-HA tag MG5A1422-CY
DDX1 cDNA ORF Clone, Mouse, N-HA tag MG5A1422-NY
DDX1 cDNA ORF Clone, Mouse, C-Myc tag MG5A1422-CM
DDX1 cDNA ORF Clone, Mouse, N-Myc tag MG5A1422-NM

DDX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX1 cDNA ORF Clone in Cloning Vector, Human HG14957-G
DDX1 cDNA ORF Clone, Human, untagged HG14957-UT
DDX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14957-ACG
DDX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14957-ACGLN
DDX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14957-ANG
DDX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14957-ACR
DDX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14957-ANR
DDX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14957-CF
DDX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14957-NF
DDX1 cDNA ORF Clone, Human, C-His tag HG14957-CH
DDX1 cDNA ORF Clone, Human, C-HA tag HG14957-CY
DDX1 cDNA ORF Clone, Human, N-HA tag HG14957-NY
DDX1 cDNA ORF Clone, Human, C-Myc tag HG14957-CM
DDX1 cDNA ORF Clone, Human, N-Myc tag HG14957-NM
DDX1 qPCR Primer Pairs, Human HP103586
info info
添加购物车成功! 添加购物车失败!