After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DDR1/MCK10/CD167 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human DDR1 cDNA Clone Product Information
NCBI RefSeq:NM_013993.2
RefSeq ORF Size:2742bp
cDNA Description:Full length Clone DNA of Homo sapiens discoidin domain receptor tyrosine kinase 1 , transcript variant 2 with C terminal Myc tag.
Gene Synonym:CAK, DDR, NEP, PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, NTRK4, PTK3A, DDR1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human DDR1/MCK10/CD167 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Product nameProduct name
Background

Discoidin domain receptor family, member 1 (DDR1), also known as or CD167a (cluster of differentiation 167a), and Mammary carcinoma kinase 10 (MCK10), belongs to a subfamily of tyrosine kinase receptors with an extracellular domain homologous to Dictyostellium discoideum protein discoidin 1. Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. Expression of DDR1/MCK10/CD167 is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. DDR1/MCK10/CD167 plays an important role in regulating attachment to collagen, chemotaxis, proliferation, and MMP production in smooth muscle cells. DDR1 functions in a feedforward loop to increase p53 levels and at least some of its effectors. Inhibition of DDR1 function resulted in strikingly increased apoptosis of wild-type p53-containing cells in response to genotoxic stress through a caspase-dependent pathway.

References
  • Hou G, et al. (2001) The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest. 107(6): 727-35.
  • Ongusaha PP, et al. (2003) p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 22(6): 1289-301.
  • Jönsson M, et al. (2001) Repression of Wnt-5a impairs DDR1 phosphorylation and modifies adhesion and migration of mammary cells. J Cell Sci. 114(11): 2043-53.
  • Size / Price
    Catalog: HG10730-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"