CHOP cDNA ORF Clone, Human, N-His tag

Cat: HG14931-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHOP Reagents
CRO Services
Product recommended

All CHOP Reagents
CHOP cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Human DNA-damage-inducible transcript 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHOP cDNA ORF Clone, Human, N-His tag Alternative Names
CEBPZ cDNA ORF Clone, Human;CHOP cDNA ORF Clone, Human;CHOP-10 cDNA ORF Clone, Human;CHOP10 cDNA ORF Clone, Human;GADD153 cDNA ORF Clone, Human
CHOP Background Information
Full Name
DNA-damage-inducible transcript 3

CHOP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CHOP cDNA ORF Clone in Cloning Vector, Rat RG82072-U
CHOP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82072-ACGLN

CHOP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHOP cDNA ORF Clone in Cloning Vector, Mouse MG53401-U
CHOP cDNA ORF Clone, Mouse, untagged MG53401-UT
CHOP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53401-ACGLN
CHOP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53401-ACG
CHOP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53401-ANG
CHOP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53401-ACR
CHOP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53401-ANR
CHOP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53401-CF
CHOP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53401-NF
CHOP cDNA ORF Clone, Mouse, C-His tag MG53401-CH
CHOP cDNA ORF Clone, Mouse, N-His tag MG53401-NH
CHOP cDNA ORF Clone, Mouse, C-HA tag MG53401-CY
CHOP cDNA ORF Clone, Mouse, N-HA tag MG53401-NY
CHOP cDNA ORF Clone, Mouse, C-Myc tag MG53401-CM
CHOP cDNA ORF Clone, Mouse, N-Myc tag MG53401-NM

CHOP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHOP cDNA ORF Clone in Cloning Vector, Human HG14931-G
CHOP cDNA ORF Clone, Human, untagged HG14931-UT
CHOP cDNA ORF Clone, Human, C-GFPSpark® tag HG14931-ACG
CHOP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14931-ACGLN
CHOP cDNA ORF Clone, Human, N-GFPSpark® tag HG14931-ANG
CHOP cDNA ORF Clone, Human, C-OFPSpark® tag HG14931-ACR
CHOP cDNA ORF Clone, Human, N-OFPSpark® tag HG14931-ANR
CHOP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14931-CF
CHOP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14931-NF
CHOP cDNA ORF Clone, Human, C-His tag HG14931-CH
CHOP cDNA ORF Clone, Human, C-HA tag HG14931-CY
CHOP cDNA ORF Clone, Human, N-HA tag HG14931-NY
CHOP cDNA ORF Clone, Human, C-Myc tag HG14931-CM
CHOP cDNA ORF Clone, Human, N-Myc tag HG14931-NM
CHOP qPCR Primer Pairs, Human HP103560
info info
添加购物车成功! 添加购物车失败!