After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DCXR / HCR2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human DCXR cDNA Clone Product Information
NCBI RefSeq:BC001470
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens dicarbonyl/L-xylulose reductase.
Gene Synonym:XR, DCR, HCR2, P34H, HCRII, KIDCR, SDR20C1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney, liver and epididymis. In the epididymis, DCXR is mainly expressed in the proximal and distal sections of the corpus region. HCR2 is weakly or not expressed in brain, lung, heart, spleen and testis. DCXR catalyzes the NADPH-dependent reduction of several pentoses, tetroses, trioses, alpha-dicarbonyl compounds and L-xylulose. DCXR participates in the uronate cycle of glucose metabolism. It may play a role in the water absorption and cellular osmoregulation in the proximal renal tubules by producing xylitol, an osmolyte, thereby preventing osmolytic stress from occurring in the renal tubules.

References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Pierce SB, et al. (2011) Garrod's fourth inborn error of metabolism solved by the identification of mutations causing pentosuria. Proc Natl Acad Sci. 108(45):18313-7.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • Size / Price
    Catalog: HG14562-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"