Quick Order

Human DCX Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human DCX cDNA Clone Product Information
NCBI RefSeq:BC027925
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens doublecortin with N terminal Flag tag.
Gene Synonym:DC, DBCN, LISX, SCLH, XLIS, DCX
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly expressed in neuronal cells of fetal brain, but not expressed in other fetal tissues. In the adult, it is highly expressed in the brain frontal lobe, but very low expression in other regions of brain, and not detected in heart, placenta, lung, liver, skeletal muscles, kidney and pancreas. DCX is a microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. It may act by competing with the putative neuronal protein kinase DCAMKL1 in binding to a target protein. DCX may in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. It may be part with LIS-1 of a overlapping, but distinct, signaling pathways that promote neuronal migration. Defects in DCX are the cause of lissencephaly X-linked type 1 and subcortical band heterotopia X-linked.

References
  • Des Portes V, et al. (1998) A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell. 92:51-61.
  • Gleeson J G, et al. (998) Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell. 92:63-72.
  • Ross M T, et al. (2005) The DNA sequence of the human X chromosome. Nature. 434:325-37.
  • Size / Price
    Catalog: HG13498-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"