Quick Order

Text Size:AAA

Human DCUN1D2 natural ORF mammalian expression plasmid

Datasheet Reviews Related Products Protocols
Human DCUN1D2 cDNA Clone Product Information
NCBI RefSeq:BC056669
RefSeq ORF Size:780bp
cDNA Description:Full length Clone DNA of Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) DNA.
Gene Synonym:C13orf17
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog:  HG15363-UT
List Price:    (Save )
Price:       [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"