DCTN4 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14815-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DCTN4 Reagents
CRO Services
Product recommended

All DCTN4 Reagents
DCTN4 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1383 bp
Description
Full length Clone DNA of Human dynactin 4 (p62) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN4 cDNA ORF Clone, Human, C-Myc tag Alternative Names
DYN4 cDNA ORF Clone, Human;P62 cDNA ORF Clone, Human
DCTN4 Background Information
Full Name
dynactin 4 (p62)

DCTN4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN4 cDNA ORF Clone in Cloning Vector, Mouse MG51373-U
DCTN4 cDNA ORF Clone in Cloning Vector, Mouse MG5A7602-U
DCTN4 cDNA ORF Clone, Mouse, untagged MG5A7602-UT
DCTN4 cDNA ORF Clone, Mouse, untagged MG51373-UT
DCTN4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51373-ACGLN
DCTN4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7602-ACG
DCTN4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7602-ACGLN
DCTN4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51373-ACG
DCTN4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51373-ANG
DCTN4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7602-ANG
DCTN4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7602-ACR
DCTN4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51373-ACR
DCTN4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7602-ANR
DCTN4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51373-ANR
DCTN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51373-CF
DCTN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7602-CF
DCTN4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7602-NF
DCTN4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51373-NF
DCTN4 cDNA ORF Clone, Mouse, C-His tag MG5A7602-CH
DCTN4 cDNA ORF Clone, Mouse, C-His tag MG51373-CH
DCTN4 cDNA ORF Clone, Mouse, N-His tag MG51373-NH
DCTN4 cDNA ORF Clone, Mouse, N-His tag MG5A7602-NH
DCTN4 cDNA ORF Clone, Mouse, C-HA tag MG51373-CY
DCTN4 cDNA ORF Clone, Mouse, C-HA tag MG5A7602-CY
DCTN4 cDNA ORF Clone, Mouse, N-HA tag MG51373-NY
DCTN4 cDNA ORF Clone, Mouse, N-HA tag MG5A7602-NY
DCTN4 cDNA ORF Clone, Mouse, C-Myc tag MG5A7602-CM
DCTN4 cDNA ORF Clone, Mouse, C-Myc tag MG51373-CM
DCTN4 cDNA ORF Clone, Mouse, N-Myc tag MG51373-NM
DCTN4 cDNA ORF Clone, Mouse, N-Myc tag MG5A7602-NM
DCTN4 qPCR Primer Pairs, Mouse MP201246

DCTN4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN4 cDNA ORF Clone in Cloning Vector, Human HG14815-G
DCTN4 cDNA ORF Clone, Human, untagged HG14815-UT
DCTN4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14815-ACGLN
DCTN4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14815-ACG
DCTN4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14815-ANG
DCTN4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14815-ACR
DCTN4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14815-ANR
DCTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14815-CF
DCTN4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14815-NF
DCTN4 cDNA ORF Clone, Human, C-His tag HG14815-CH
DCTN4 cDNA ORF Clone, Human, N-His tag HG14815-NH
DCTN4 cDNA ORF Clone, Human, C-HA tag HG14815-CY
DCTN4 cDNA ORF Clone, Human, N-HA tag HG14815-NY
DCTN4 cDNA ORF Clone, Human, N-Myc tag HG14815-NM
DCTN4 qPCR Primer Pairs, Human HP103447
info info
添加购物车成功! 添加购物车失败!