DCTN3 cDNA ORF Clone, Human, untagged

Cat: HG14361-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCTN3 Reagents
CRO Services
Product recommended

All DCTN3 Reagents
DCTN3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Human dynactin 3 (p22).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN3 cDNA ORF Clone, Human, untagged Alternative Names
DCTN-22 cDNA ORF Clone, Human;DCTN22 cDNA ORF Clone, Human
DCTN3 Background Information
Full Name
dynactin 3 (p22)

DCTN3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Rat RG81338-G
DCTN3 cDNA ORF Clone, Rat, untagged RG81338-UT
DCTN3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81338-ACGLN
DCTN3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81338-ACG
DCTN3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81338-ANG
DCTN3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81338-ACR
DCTN3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81338-ANR
DCTN3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81338-CF
DCTN3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81338-NF
DCTN3 cDNA ORF Clone, Rat, C-His tag RG81338-CH
DCTN3 cDNA ORF Clone, Rat, N-His tag RG81338-NH
DCTN3 cDNA ORF Clone, Rat, C-HA tag RG81338-CY
DCTN3 cDNA ORF Clone, Rat, N-HA tag RG81338-NY
DCTN3 cDNA ORF Clone, Rat, C-Myc tag RG81338-CM
DCTN3 cDNA ORF Clone, Rat, N-Myc tag RG81338-NM
DCTN3 qPCR Primer Pairs, Rat RP301284

DCTN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Mouse MG53793-U
DCTN3 cDNA ORF Clone, Mouse, untagged MG53793-UT
DCTN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53793-ACG
DCTN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53793-ACGLN
DCTN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53793-ANG
DCTN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53793-ACR
DCTN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53793-ANR
DCTN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53793-CF
DCTN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53793-NF
DCTN3 cDNA ORF Clone, Mouse, C-His tag MG53793-CH
DCTN3 cDNA ORF Clone, Mouse, N-His tag MG53793-NH
DCTN3 cDNA ORF Clone, Mouse, C-HA tag MG53793-CY
DCTN3 cDNA ORF Clone, Mouse, N-HA tag MG53793-NY
DCTN3 cDNA ORF Clone, Mouse, C-Myc tag MG53793-CM
DCTN3 cDNA ORF Clone, Mouse, N-Myc tag MG53793-NM

DCTN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN3 cDNA ORF Clone in Cloning Vector, Human HG14361-G
DCTN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14361-ACG
DCTN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14361-ACGLN
DCTN3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14361-ANG
DCTN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14361-ACR
DCTN3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14361-ANR
DCTN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14361-CF
DCTN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14361-NF
DCTN3 cDNA ORF Clone, Human, C-His tag HG14361-CH
DCTN3 cDNA ORF Clone, Human, N-His tag HG14361-NH
DCTN3 cDNA ORF Clone, Human, C-HA tag HG14361-CY
DCTN3 cDNA ORF Clone, Human, N-HA tag HG14361-NY
DCTN3 cDNA ORF Clone, Human, C-Myc tag HG14361-CM
DCTN3 cDNA ORF Clone, Human, N-Myc tag HG14361-NM
DCTN3 qPCR Primer Pairs, Human HP103010
info info
添加购物车成功! 添加购物车失败!