DCTN1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15542-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCTN1 Reagents
CRO Services
Product recommended

All DCTN1 Reagents
DCTN1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3420 bp
Description
Full length Clone DNA of Human dynactin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
DAP-150 cDNA ORF Clone, Human;DP-150 cDNA ORF Clone, Human;P135 cDNA ORF Clone, Human
DCTN1 Background Information
Full Name
dynactin subunit 1

DCTN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN1 cDNA ORF Clone in Cloning Vector, Mouse MG52842-G
DCTN1 cDNA ORF Clone, Mouse, untagged MG52842-UT
DCTN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52842-ACGLN
DCTN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52842-ACG
DCTN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52842-ANG
DCTN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52842-ACR
DCTN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52842-ANR
DCTN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52842-CF
DCTN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52842-NF
DCTN1 cDNA ORF Clone, Mouse, C-His tag MG52842-CH
DCTN1 cDNA ORF Clone, Mouse, N-His tag MG52842-NH
DCTN1 cDNA ORF Clone, Mouse, C-HA tag MG52842-CY
DCTN1 cDNA ORF Clone, Mouse, N-HA tag MG52842-NY
DCTN1 cDNA ORF Clone, Mouse, C-Myc tag MG52842-CM
DCTN1 cDNA ORF Clone, Mouse, N-Myc tag MG52842-NM

DCTN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN1 cDNA ORF Clone in Cloning Vector, Human HG15542-G
DCTN1 cDNA ORF Clone, Human, untagged HG15542-UT
DCTN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15542-ACG
DCTN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15542-ACGLN
DCTN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15542-ANG
DCTN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15542-ACR
DCTN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15542-ANR
DCTN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15542-CF
DCTN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15542-NF
DCTN1 cDNA ORF Clone, Human, C-His tag HG15542-CH
DCTN1 cDNA ORF Clone, Human, N-His tag HG15542-NH
DCTN1 cDNA ORF Clone, Human, C-HA tag HG15542-CY
DCTN1 cDNA ORF Clone, Human, N-HA tag HG15542-NY
DCTN1 cDNA ORF Clone, Human, C-Myc tag HG15542-CM
DCTN1 qPCR Primer Pairs, Human HP104163
info info
添加购物车成功! 添加购物车失败!