Decorin cDNA ORF Clone, Human, N-His tag

Cat: HG10189-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Decorin Reagents
CRO Services
Product recommended

All Decorin Reagents
Decorin cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Human decorin, transcript variant A1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Decorin cDNA ORF Clone, Human, N-His tag Alternative Names
CSCD cDNA ORF Clone, Human;DSPG2 cDNA ORF Clone, Human;PG40 cDNA ORF Clone, Human;PGII cDNA ORF Clone, Human;PGS2 cDNA ORF Clone, Human;SLRR1B cDNA ORF Clone, Human
Decorin Background Information

Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan protein. It belongs to the small leucine-rich proteoglycan (SLRP) family and consists of a core protein and a covalently linked glycosaminoglycan chain which is either chondroitin sulfate (CS) or dermatan sulfate (DS). As a component of connective tissue, decorin interacts with several extracellular matrix components, such as type I collagen and fibronectin, and plays a role in matrix assembly. Decorin resides in the tumor microenvironment and affects the biology of various types of cancer by downregulating the activity of several receptors involved in cell growth and survival. Decorin binds to and modulates the signaling of the epidermal growth factor receptor and other members of the ErbB family of receptor tyrosine kinases. It exerts its antitumor activity by a dual mechanism: via inhibition of these key receptors through their physical downregulation coupled with attenuation of their signaling, and by binding to and sequestering TGFbeta. Decorin also modulates the insulin-like growth factor receptor and the low-density lipoprotein receptor-related protein 1, which indirectly affects the TGFbeta receptor pathway. Decorin plays significant roles in tissue development and assembly, as well as playing both direct and indirect signaling roles.

Full Name
decorin
References
  • Mogyorsi A, et al. (1999) What is the role of decorin in diabetic kidney disease? Nephrol Dial Transplant. 14(5): 1078-81.
  • Reed CC, et al. (2002) The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj J. 19(4-5): 249-55.
  • Goldoni S, et al. (2008) Tumor microenvironment: Modulation by decorin and related molecules harboring leucine-rich tandem motifs. Int J Cancer. 123(11): 2473-9.
  • Decorin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Decorin cDNA ORF Clone in Cloning Vector, Rat RG8A6937-U
    Decorin cDNA ORF Clone in Cloning Vector, Rat RG80656-U
    Decorin cDNA ORF Clone, Rat, untagged RG80656-UT
    Decorin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6937-ACGLN
    Decorin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80656-ACG
    Decorin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80656-ACGLN
    Decorin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80656-ACR
    Decorin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80656-CF
    Decorin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80656-NF
    Decorin cDNA ORF Clone, Rat, C-His tag RG80656-CH
    Decorin cDNA ORF Clone, Rat, N-His tag RG80656-NH
    Decorin cDNA ORF Clone, Rat, C-HA tag RG80656-CY
    Decorin cDNA ORF Clone, Rat, N-HA tag RG80656-NY
    Decorin cDNA ORF Clone, Rat, C-Myc tag RG80656-CM
    Decorin cDNA ORF Clone, Rat, N-Myc tag RG80656-NM
    Decorin qPCR Primer Pairs, Rat RP300620

    Decorin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Decorin cDNA ORF Clone in Cloning Vector, Mouse MG51501-U
    Decorin cDNA ORF Clone, Mouse, untagged MG51501-UT
    Decorin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51501-ACG
    Decorin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51501-ACGLN
    Decorin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51501-ACR
    Decorin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51501-CF
    Decorin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51501-NF
    Decorin cDNA ORF Clone, Mouse, C-His tag MG51501-CH
    Decorin cDNA ORF Clone, Mouse, N-His tag MG51501-NH
    Decorin cDNA ORF Clone, Mouse, C-HA tag MG51501-CY
    Decorin cDNA ORF Clone, Mouse, N-HA tag MG51501-NY
    Decorin cDNA ORF Clone, Mouse, C-Myc tag MG51501-CM
    Decorin cDNA ORF Clone, Mouse, N-Myc tag MG51501-NM
    Decorin qPCR Primer Pairs, Mouse MP201385

    Decorin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Decorin cDNA ORF Clone in Cloning Vector, Human HG10189-M
    Decorin cDNA ORF Clone, Human, untagged HG10189-UT
    Decorin cDNA ORF Clone, Human, C-GFPSpark® tag HG10189-ACG
    Decorin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10189-ACGLN
    Decorin cDNA ORF Clone, Human, C-OFPSpark® tag HG10189-ACR
    Decorin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10189-CF
    Decorin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10189-NF
    Decorin cDNA ORF Clone, Human, C-His tag HG10189-CH
    Decorin cDNA ORF Clone, Human, C-HA tag HG10189-CY
    Decorin cDNA ORF Clone, Human, N-HA tag HG10189-NY
    Decorin cDNA ORF Clone, Human, C-Myc tag HG10189-CM
    Decorin cDNA ORF Clone, Human, N-Myc tag HG10189-NM
    Decorin qPCR Primer Pairs, Human HP100255
    info info
    添加购物车成功! 添加购物车失败!