Text Size:AAA

Human Decorin/DCN transcript variant A1 Gene ORF cDNA clone expression plasmid, C-Flag tag

  • Human DCN / Decorin transcript variant A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
  • Human DCN / Decorin transcript variant A1 ORF mammalian expression plasmid, C-Flag tag
DatasheetReviewsRelated ProductsProtocols
Human DCN cDNA Clone Product Information
NCBI RefSeq:NM_001920.3
RefSeq ORF Size:1080bp
cDNA Description:Full length Clone DNA of Homo sapiens decorin, transcript variant A1 with C terminal Flag tag.
Gene Synonym:DCN, CSCD, PG40, PGII, PGS2, DSPG2, SLRR1B
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-DCN-Flag
Restriction Site:KpnI + XbaI (6kb + 1.13kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DCN qPCR primers for gene expression analysis, HP100255 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DCN Gene Plasmid Map
Human DCN / Decorin transcript variant A1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human DCN Gene Expression validated Image
Human DCN / Decorin transcript variant A1 ORF mammalian expression plasmid, C-Flag tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan protein. It belongs to the small leucine-rich proteoglycan (SLRP) family and consists of a core protein and a covalently linked glycosaminoglycan chain which is either chondroitin sulfate (CS) or dermatan sulfate (DS). As a component of connective tissue, decorin interacts with several extracellular matrix components, such as type I collagen and fibronectin, and plays a role in matrix assembly. Decorin resides in the tumor microenvironment and affects the biology of various types of cancer by downregulating the activity of several receptors involved in cell growth and survival. Decorin binds to and modulates the signaling of the epidermal growth factor receptor and other members of the ErbB family of receptor tyrosine kinases. It exerts its antitumor activity by a dual mechanism: via inhibition of these key receptors through their physical downregulation coupled with attenuation of their signaling, and by binding to and sequestering TGFbeta. Decorin also modulates the insulin-like growth factor receptor and the low-density lipoprotein receptor-related protein 1, which indirectly affects the TGFbeta receptor pathway. Decorin plays significant roles in tissue development and assembly, as well as playing both direct and indirect signaling roles.

References
  • Mogyorsi A, et al. (1999) What is the role of decorin in diabetic kidney disease? Nephrol Dial Transplant. 14(5): 1078-81.
  • Reed CC, et al. (2002) The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj J. 19(4-5): 249-55.
  • Goldoni S, et al. (2008) Tumor microenvironment: Modulation by decorin and related molecules harboring leucine-rich tandem motifs. Int J Cancer. 123(11): 2473-9.
  • Size / Price
    Catalog: HG10189-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"