CLEC4A cDNA ORF Clone, Human, N-Myc tag

Cat: HG11476-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLEC4A Reagents
CRO Services
Product recommended

All CLEC4A Reagents
CLEC4A cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Human C-type lectin domain family 4, member A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC4A cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD367 cDNA ORF Clone, Human;CLEC4A cDNA ORF Clone, Human;CLECSF6 cDNA ORF Clone, Human;DCIR cDNA ORF Clone, Human;DDB27 cDNA ORF Clone, Human;HDCGC13P cDNA ORF Clone, Human;LLIR cDNA ORF Clone, Human
CLEC4A Background Information

Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin superfamily member 6 (CLECSF6), is a single-pass type II C-type lectin receptor expressed mainly in dendritic cells (DCs), which is a negative regulator of DC expansion and has a crucial role in maintaining the homeostasis of the immune system. The Dectin-2 family of C-type lectins that includes Dectin-2, BDCA-2, DCIR, DCAR, Clecsf8 and Mincle. These type II receptors contain a single extracellular carbohydrate recognition domain and have diverse functions in both immunity and homeostasis. DCIR is the only member of the family which contains a cytoplasmic signalling motif and has been shown to act as an inhibitory receptor, while BDCA-2, Dectin-2, DCAR and Mincle all associate with FcRgamma chain to induce cellular activation, including phagocytosis and cytokine production. Dectin-2 and Mincle have been shown to act as pattern recognition receptors for fungi, while DCIR acts as an attachment factor for HIV. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. DCIR expressed on antigen presenting cells and granulocytes and acts as an inhibitory receptor via an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM). It may also be involved via its ITIM motif in the inhibition of B-cell-receptor-mediated calcium mobilization and protein tyrosine phosphorylation. Additionally, DCIR can participate in the capture of HIV-1 and promote infection in trans and in cis of autologous CD4(+) T cells from human immature monocyte-derived DCs. DCIR acts as a ligand for HIV-1 and is involved in events leading to productive virus infection.

Full Name
C-type lectin domain family 4 member A
References
  • Kanazawa N, et al. (2004) Signaling and immune regulatory role of the dendritic cell immunoreceptor (DCIR) family lectins: DCIR, DCAR, dectin-2 and BDCA-2. Immunobiology. 209(1-2): 179-90.
  • Fujikado N, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med. 14(2): 176-80.
  • Lambert AA, et al. (2008) The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood. 112(4): 1299-307.
  • Graham LM, et al. (2009) The Dectin-2 family of C-type lectins in immunity and homeostasis. Cytokine. 48(1-2): 148-55.
  • info info
    添加购物车成功! 添加购物车失败!