Quick Order

Text Size:AAA

Human DCIR/CLEC4A/CLECSF6 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CLEC4A cDNA Clone Product Information
NCBI RefSeq:NM_016184.3
RefSeq ORF Size:714bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member A with N terminal Myc tag.
Gene Synonym:DCIR, LLIR, DDB27, CLECSF6, HDCGC13P, CLEC4A
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin superfamily member 6 (CLECSF6), is a single-pass type II C-type lectin receptor expressed mainly in dendritic cells (DCs), which is a negative regulator of DC expansion and has a crucial role in maintaining the homeostasis of the immune system. The Dectin-2 family of C-type lectins that includes Dectin-2, BDCA-2, DCIR, DCAR, Clecsf8 and Mincle. These type II receptors contain a single extracellular carbohydrate recognition domain and have diverse functions in both immunity and homeostasis. DCIR is the only member of the family which contains a cytoplasmic signalling motif and has been shown to act as an inhibitory receptor, while BDCA-2, Dectin-2, DCAR and Mincle all associate with FcRgamma chain to induce cellular activation, including phagocytosis and cytokine production. Dectin-2 and Mincle have been shown to act as pattern recognition receptors for fungi, while DCIR acts as an attachment factor for HIV. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. DCIR expressed on antigen presenting cells and granulocytes and acts as an inhibitory receptor via an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM). It may also be involved via its ITIM motif in the inhibition of B-cell-receptor-mediated calcium mobilization and protein tyrosine phosphorylation. Additionally, DCIR can participate in the capture of HIV-1 and promote infection in trans and in cis of autologous CD4(+) T cells from human immature monocyte-derived DCs. DCIR acts as a ligand for HIV-1 and is involved in events leading to productive virus infection.

References
  • Kanazawa N, et al. (2004) Signaling and immune regulatory role of the dendritic cell immunoreceptor (DCIR) family lectins: DCIR, DCAR, dectin-2 and BDCA-2. Immunobiology. 209(1-2): 179-90.
  • Fujikado N, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med. 14(2): 176-80.
  • Lambert AA, et al. (2008) The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood. 112(4): 1299-307.
  • Graham LM, et al. (2009) The Dectin-2 family of C-type lectins in immunity and homeostasis. Cytokine. 48(1-2): 148-55.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"