Text Size:AAA

Human DCBLD2 / ESDN / CLCP1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human DCBLD2 cDNA Clone Product Information
    NCBI RefSeq:BC029658
    RefSeq ORF Size:2232bp
    cDNA Description:Full length Clone DNA of Homo sapiens discoidin, CUB and LCCL domain containing 2.
    Gene Synonym:ESDN, CLCP1, DCBLD2
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DCBLD2 qPCR primers for gene expression analysis, HP102300 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and is regulated by transcription factor AP-2 alpha (TFAP2A), a component of activator protein-2 (AP-2) that is known to regulate IL-8 production in human lung fibroblasts and epithelial cells. DCBLD2 could be related to FEV(1)-related phenotypes in asthmatics. DCBLD2 gene is expressed at very high level. DCBLD2 is proposed to participate in processes such as intracellular receptor mediated signaling pathway, negative regulation of cell growth and so on.

    References
  • Kobuke K. et al., 2001, J Biol Chem. 276 (36): 34105-14.
  • Adeghi MM. et al., 2007, Am J Transplant. 7 (9): 2098-105.
  • Chen Y. et al., 2007, Proteomics. 7 (14): 2384-97.
  • Park TJ. et al., 2012, J Korean Med Sci. 27 (4): 343-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"