HIP55/DBNL cDNA ORF Clone, Human, untagged

Cat: HG14464-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HIP55/DBNL Reagents
CRO Services
Product recommended

All HIP55/DBNL Reagents
HIP55/DBNL cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Human drebrin-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIP55/DBNL cDNA ORF Clone, Human, untagged Alternative Names
ABP1 cDNA ORF Clone, Human;HIP-55 cDNA ORF Clone, Human;HIP55 cDNA ORF Clone, Human;SH3P7 cDNA ORF Clone, Human
HIP55/DBNL Background Information
Full Name
drebrin-like

HIP55/DBNL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HIP55/DBNL cDNA ORF Clone in Cloning Vector, Rat RG85968-U
HIP55/DBNL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85968-ACGLN

HIP55/DBNL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HIP55/DBNL cDNA ORF Clone in Cloning Vector, Mouse MG51822-G
HIP55/DBNL cDNA ORF Clone, Mouse, untagged MG51822-UT
HIP55/DBNL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51822-ACGLN
HIP55/DBNL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51822-ACG
HIP55/DBNL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51822-ANG
HIP55/DBNL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51822-ACR
HIP55/DBNL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51822-ANR
HIP55/DBNL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51822-CF
HIP55/DBNL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51822-NF
HIP55/DBNL cDNA ORF Clone, Mouse, C-His tag MG51822-CH
HIP55/DBNL cDNA ORF Clone, Mouse, N-His tag MG51822-NH
HIP55/DBNL cDNA ORF Clone, Mouse, C-HA tag MG51822-CY
HIP55/DBNL cDNA ORF Clone, Mouse, N-HA tag MG51822-NY
HIP55/DBNL cDNA ORF Clone, Mouse, C-Myc tag MG51822-CM
HIP55/DBNL cDNA ORF Clone, Mouse, N-Myc tag MG51822-NM
HIP55/DBNL qPCR Primer Pairs, Mouse MP201695

HIP55/DBNL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HIP55/DBNL cDNA ORF Clone in Cloning Vector, Human HG14464-G
HIP55/DBNL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14464-ACGLN
HIP55/DBNL cDNA ORF Clone, Human, C-GFPSpark® tag HG14464-ACG
HIP55/DBNL cDNA ORF Clone, Human, N-GFPSpark® tag HG14464-ANG
HIP55/DBNL cDNA ORF Clone, Human, C-OFPSpark® tag HG14464-ACR
HIP55/DBNL cDNA ORF Clone, Human, N-OFPSpark® tag HG14464-ANR
HIP55/DBNL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14464-CF
HIP55/DBNL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14464-NF
HIP55/DBNL cDNA ORF Clone, Human, C-His tag HG14464-CH
HIP55/DBNL cDNA ORF Clone, Human, N-His tag HG14464-NH
HIP55/DBNL cDNA ORF Clone, Human, C-HA tag HG14464-CY
HIP55/DBNL cDNA ORF Clone, Human, N-HA tag HG14464-NY
HIP55/DBNL cDNA ORF Clone, Human, C-Myc tag HG14464-CM
HIP55/DBNL cDNA ORF Clone, Human, N-Myc tag HG14464-NM
HIP55/DBNL qPCR Primer Pairs, Human HP103112
info info
添加购物车成功! 添加购物车失败!