DARS cDNA ORF Clone, Human, C-Myc tag

Cat: HG14278-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DARS Reagents
CRO Services
Product recommended

All DARS Reagents
DARS cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Description
Full length Clone DNA of Human aspartyl-tRNA synthetase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DARS cDNA ORF Clone, Human, C-Myc tag Alternative Names
aspRS cDNA ORF Clone, Human;HBSL cDNA ORF Clone, Human
DARS Background Information

Aspartate tRNA ligase 1, also known as DARS, is part of a multienzyme complex of aminoacyl-tRNA synthetases. It belongs to the class-II aminoacyl-tRNA synthetase family. DARS charges its cognate tRNA with aspartate during protein biosynthesis. DARS catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid(AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.

Full Name
aspartyl-tRNA synthetase
References
  • Escalante C, et al. (1993) Expression of human aspartyl-tRNA synthetase in Escherichia coli. Functional analysis of the N-terminal putative amphiphilic helix. J Biol Chem. 268(8): 6014-23.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Reed VS, et al. (1995) Mechanisms of the transfer of aminoacyl-tRNA from aminoacyl-tRNA synthetase to the elongation factor 1 alpha. J Biol Chem. 269(52):32932-6.
  • DARS cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    DARS cDNA ORF Clone in Cloning Vector, Rat RG81367-G

    DARS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DARS cDNA ORF Clone in Cloning Vector, Mouse MG52211-G
    DARS cDNA ORF Clone, Mouse, untagged MG52211-UT
    DARS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52211-ACGLN
    DARS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52211-ACG
    DARS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52211-ANG
    DARS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52211-ACR
    DARS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52211-ANR
    DARS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52211-CF
    DARS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52211-NF
    DARS cDNA ORF Clone, Mouse, C-His tag MG52211-CH
    DARS cDNA ORF Clone, Mouse, N-His tag MG52211-NH
    DARS cDNA ORF Clone, Mouse, C-HA tag MG52211-CY
    DARS cDNA ORF Clone, Mouse, N-HA tag MG52211-NY
    DARS cDNA ORF Clone, Mouse, C-Myc tag MG52211-CM
    DARS cDNA ORF Clone, Mouse, N-Myc tag MG52211-NM
    DARS qPCR Primer Pairs, Mouse MP202084

    DARS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DARS cDNA ORF Clone in Cloning Vector, Human HG14278-G
    DARS cDNA ORF Clone, Human, untagged HG14278-UT
    DARS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14278-ACGLN
    DARS cDNA ORF Clone, Human, C-GFPSpark® tag HG14278-ACG
    DARS cDNA ORF Clone, Human, N-GFPSpark® tag HG14278-ANG
    DARS cDNA ORF Clone, Human, C-OFPSpark® tag HG14278-ACR
    DARS cDNA ORF Clone, Human, N-OFPSpark® tag HG14278-ANR
    DARS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14278-CF
    DARS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14278-NF
    DARS cDNA ORF Clone, Human, C-His tag HG14278-CH
    DARS cDNA ORF Clone, Human, N-His tag HG14278-NH
    DARS cDNA ORF Clone, Human, C-HA tag HG14278-CY
    DARS cDNA ORF Clone, Human, N-HA tag HG14278-NY
    DARS cDNA ORF Clone, Human, N-Myc tag HG14278-NM
    DARS qPCR Primer Pairs, Human HP102928
    info info
    添加购物车成功! 添加购物车失败!