Quick Order

Human NBL1/DAND1 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human NBL1 cDNA Clone Product Information
NCBI RefSeq:NM_005380.4
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens neuroblastoma, suppression of tumorigenicity 1 (NBL1), transcript variant 2 with Flag tag.
Gene Synonym:NBL1, NB, DAN, NO3, DAND1, MGC8972, D1S1733E
Restriction Site:KpnI + XhoI (5.4kb + 0.59kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NBL1 Gene Plasmid Map
Human DAN/NBL1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

The Dan (Differential screening-selected gene aberrative in neuroblastoma, also known as N03) gene was first identified as the putative rat tumor suppressor gene and encodes a protein structurally related to Cerberus and Gremlin in vertebrates. It is a founding member of the DAN family of secreted proteins, acts as an inhibitor of cell cycle progression and is closely involved in retinoic acid-induced neuroblastoma differentiation. There are at least five mammalian protein members in the evolutionarily conserved Dan family including DAN, Gremlin/DRM, Cer1 (Cerberus-related), Dante and PRDC (protein related to DAN and cereberus), and share the C-terminal cystine-knot motif. As a secreted glycoprotein, DAN is a member of a class of glycoproteins shown to be secreted inhibitors of the transforming growth factor-beta (TGF-beta) and bone morphogenic protein pathways. It binds to BMPs and preventing their interactions with signaling receptor complexes, and accordingly regulates the processes of embryonic development and tissue differentiation. DAN gene product may have an important role in regulation of the entry of cells into the S phase. In addition, DAN gene product possesses an ability to revert phenotypes of transformed rat fibroblasts and represents a candidate tumour suppressor gene for neuroblastoma.

  • Ozaki T, et al. (1995) Overexpression of DAN gene product in normal rat fibroblasts causes a retardation of the entry into the S phase. Cancer Res. 55(4): 895-900.
  • Nakamura Y, et al. (1997) A product of DAN, a novel candidate tumour suppressor gene, is secreted into culture medium and suppresses DNA synthesis. Eur J Cancer. 33(12): 1986-90.
  • Ogita J, et al. (2001) Expression of the Dan gene during chicken embryonic development. Mech Dev. 109(2): 363-5.
  • Kim AS, et al. (2003) Expression of the BMP antagonist Dan during murine forebrain development. Brain Res Dev Brain Res. 145(1): 159-62.
  • Size / Price
    Catalog: HG10169-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human DAN/NBL1 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.