Cystatin F cDNA ORF Clone, Human, N-His tag

Cat: HG10167-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cystatin F Reagents
CRO Services
Product recommended

All Cystatin F Reagents
Cystatin F cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human cystatin F (leukocystatin) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin F cDNA ORF Clone, Human, N-His tag Alternative Names
CMAP cDNA ORF Clone, Human
Cystatin F Background Information

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.

Full Name
cystatin F (leukocystatin)
References
  • Halfon S., et al.,(1998), Leukocystatin, a new class II cystatin expressed selectively by hematopoietic cells. J. Biol. Chem. 273:16400-16408.
  • Ni J., et al., (1998), Cystatin F is a glycosylated human low molecular weight cysteine proteinase inhibitor.J. Biol. Chem. 273:24797-24804.
  • Morita M., et al.,(2000), Genomic construct and mapping of the gene for CMAP (leukocystatin/cystatin F, CST7) and identification of a proximal novel gene, BSCv (C20orf3).Genomics 67:87-91.
  • Cystatin F cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cystatin F cDNA ORF Clone in Cloning Vector, Mouse MG50236-M
    Cystatin F cDNA ORF Clone, Mouse, untagged MG50236-UT
    Cystatin F cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50236-ACG
    Cystatin F Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50236-ACGLN
    Cystatin F cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50236-ACR
    Cystatin F cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50236-CF
    Cystatin F cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50236-NF
    Cystatin F cDNA ORF Clone, Mouse, C-His tag MG50236-CH
    Cystatin F cDNA ORF Clone, Mouse, N-His tag MG50236-NH
    Cystatin F cDNA ORF Clone, Mouse, C-HA tag MG50236-CY
    Cystatin F cDNA ORF Clone, Mouse, N-HA tag MG50236-NY
    Cystatin F cDNA ORF Clone, Mouse, C-Myc tag MG50236-CM
    Cystatin F cDNA ORF Clone, Mouse, N-Myc tag MG50236-NM
    Cystatin F qPCR Primer Pairs, Mouse MP200262

    Cystatin F cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cystatin F cDNA ORF Clone in Cloning Vector, Human HG10167-M
    Cystatin F cDNA ORF Clone, Human, untagged HG10167-UT
    Cystatin F Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10167-ACGLN
    Cystatin F cDNA ORF Clone, Human, C-GFPSpark® tag HG10167-ACG
    Cystatin F cDNA ORF Clone, Human, C-OFPSpark® tag HG10167-ACR
    Cystatin F cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10167-CF
    Cystatin F cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10167-NF
    Cystatin F cDNA ORF Clone, Human, C-His tag HG10167-CH
    Cystatin F cDNA ORF Clone, Human, C-HA tag HG10167-CY
    Cystatin F cDNA ORF Clone, Human, N-HA tag HG10167-NY
    Cystatin F cDNA ORF Clone, Human, C-Myc tag HG10167-CM
    Cystatin F cDNA ORF Clone, Human, N-Myc tag HG10167-NM
    Cystatin F qPCR Primer Pairs, Human HP100235
    info info
    添加购物车成功! 添加购物车失败!