After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Cystatin 7 / CST7 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CST7 cDNA Clone Product Information
NCBI RefSeq:NM_003650.2
RefSeq ORF Size:504bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin F (leukocystatin) with N terminal His tag.
Gene Synonym:CST7, CMAP
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The cystatin superfamily members are important natural cysteine protease inhibitors present in a wide variety of organisms and are divided into three classes. Cystatin F, also known as leukocystatin and CMAP (Cystatin-like Metastasis-Associated Protein), is a type 2 cystatin and its expression is limited to hematopoietic cells, with the highest expression levels being observed in monocytes, dendritic cells, and certain types of T-cells. Furthermore, cystatin F mRNA becomes up-regulated during dendritic cell maturation, and thus suggests a specific role of cystatin F in immune regulation. Cystatin F is produced as a dimer, an inactive cathepsin inhibitor which is activated by chemical reduction. In addition, Cystatin F and its homologues have been observed expressing in various human cancer cell lines established from malignant tumors, and thus indicates a new diagnosis and prevention approach of certain human carcinomas metastasis.

Size / Price
Catalog: HG10167-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"