Cystatin B cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10435-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cystatin B Reagents
CRO Services
Product recommended

All Cystatin B Reagents
Cystatin B cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Description
Full length Clone DNA of Human cystatin B (stefin B) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cystatin B cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CST6 cDNA ORF Clone, Human;EPM1 cDNA ORF Clone, Human;EPM1A cDNA ORF Clone, Human;PME cDNA ORF Clone, Human;STFB cDNA ORF Clone, Human;ULD cDNA ORF Clone, Human
Cystatin B Background Information

Cystatin-B, also known as CPI-B, Liver thiol proteinase inhibitor, Stefin-B, CSTB and CST6, is a cytoplasm and nucleus protein which belongs to the cystatin family. Cystatin-B / CSTB is an intracellular thiol proteinase inhibitor. Tightly binding reversible inhibitor of cathepsins L, H and B. Cystatin-B / CSTB is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. Cystatin-B / CSTB is also thought to play a role in protecting against the proteases leaking from lysosomes. Defects in Cystatin-B / CSTB are the cause of progressive myoclonic epilepsy type 1 (EPM1) which is an autosomal recessive disorder characterized by severe, stimulus-sensitive myoclonus and tonic-clonic seizures. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Full Name
cystatin B (stefin B)
References
  • Ritonja A., et al.,(1985), Amino acid sequence of the intracellular cysteine proteinase inhibitor cystatin B from human liver. Biochem. Biophys. Res. Commun. 131:1187-1192.
  • Pennacchio L.A., et al., (1996), Mutations in the gene encoding cystatin B in progressive myoclonus epilepsy (EPM1).Science 271:1731-1734.
  • Hattori M., et al.,(2000), The DNA sequence of human chromosome 21.Nature 405:311-319.
  • Cystatin B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cystatin B cDNA ORF Clone in Cloning Vector, Rat RG81563-G

    Cystatin B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cystatin B cDNA ORF Clone, Mouse, untagged MG59102-UT
    Cystatin B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59102-ACG
    Cystatin B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59102-ACGLN
    Cystatin B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59102-ANG
    Cystatin B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59102-ACR
    Cystatin B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59102-ANR
    Cystatin B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59102-CF
    Cystatin B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59102-NF
    Cystatin B cDNA ORF Clone, Mouse, C-His tag MG59102-CH
    Cystatin B cDNA ORF Clone, Mouse, N-His tag MG59102-NH
    Cystatin B cDNA ORF Clone, Mouse, C-HA tag MG59102-CY
    Cystatin B cDNA ORF Clone, Mouse, N-HA tag MG59102-NY
    Cystatin B cDNA ORF Clone, Mouse, C-Myc tag MG59102-CM
    Cystatin B cDNA ORF Clone, Mouse, N-Myc tag MG59102-NM

    Cystatin B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cystatin B cDNA ORF Clone in Cloning Vector, Human HG10435-M
    Cystatin B cDNA ORF Clone, Human, untagged HG10435-UT
    Cystatin B cDNA ORF Clone, Human, C-GFPSpark® tag HG10435-ACG
    Cystatin B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10435-ACGLN
    Cystatin B cDNA ORF Clone, Human, N-GFPSpark® tag HG10435-ANG
    Cystatin B cDNA ORF Clone, Human, C-OFPSpark® tag HG10435-ACR
    Cystatin B cDNA ORF Clone, Human, N-OFPSpark® tag HG10435-ANR
    Cystatin B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10435-NF
    Cystatin B cDNA ORF Clone, Human, C-His tag HG10435-CH
    Cystatin B cDNA ORF Clone, Human, N-His tag HG10435-NH
    Cystatin B cDNA ORF Clone, Human, C-HA tag HG10435-CY
    Cystatin B cDNA ORF Clone, Human, N-HA tag HG10435-NY
    Cystatin B cDNA ORF Clone, Human, C-Myc tag HG10435-CM
    Cystatin B cDNA ORF Clone, Human, N-Myc tag HG10435-NM
    Cystatin B qPCR Primer Pairs, Human HP100465
    info info
    添加购物车成功! 添加购物车失败!