Quick Order

Human Cystatin A / CSTA Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CSTA cDNA Clone Product Information
NCBI RefSeq:NM_005213.3
RefSeq ORF Size:297bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin A (stefin A) with C terminal Flag tag.
Gene Synonym:STF1, STFA, CSTA
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to the cystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Catalog: HG10479-CF
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"