Quick Order

Human C5a/Complement 5a Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human C5 cDNA Clone Product Information
NCBI RefSeq:NM_001735.2
RefSeq ORF Size:5031bp
cDNA Description:Full length Clone DNA of Homo sapiens complement component 5.
Gene Synonym:CPAMD4, C5
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.

References
  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.
  • Size / Price
    Catalog: HG13416-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"