After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Chitotriosidase/Chitinase 1/CHIT1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CHIT1 cDNA Clone Product Information
NCBI RefSeq:NM_003465.2
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Homo sapiens chitinase 1 (chitotriosidase).
Gene Synonym:CHI3, CHIT, FLJ00314, MGC125322
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CHIT1
Restriction Site:KpnI + XbaI (6.1kb + 1.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CHIT1 Gene Plasmid Map
Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

References
  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Size / Price
    Catalog: HG11223-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human Chitotriosidase / Chitinase 1 / CHIT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"