Quick Order

Human Cathepsin E/CTSE Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CTSE cDNA Clone Product Information
NCBI RefSeq:NM_001910.2
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Homo sapiens cathepsin E with C terminal HA tag.
Gene Synonym:CATE, CTSE
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Cathepsin E Protein (CTSE Protein) is a member of the peptidase C1 family that is a gastric aspartic protease that functions as a disulfide-linked homodimer. Cathepsin E Protein (CTSE Protein) is predominantly present in the cells of immune system and is frequently implicated in antigen processing via the MHC classⅡ pathway which however does not appear to be involved in the digestion of dietary protein. The protein has a specificity similar to that of pepsin and pepsin. Cathepsin E Protein (CTSE Protein) is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach and also been found in more than half of the gastric cancers. It appears, therefore, to be an oncofetal antigen.

References
  • Zaidi N, et al. (2008) Emerging functional foles of cathepsin E. Biochem Biophys Res Commun. 377(2) : 327-30.
  • Zaidi N, et al. (2008) Cathepsin E: a mini review. Biochem Biophys Res Commun. 367(3) :517-22.
  • Azuma T, et al. (1989) Human gastric cathepsin E Predicted sequence, localization to chromosome 1, and sequence homology with other aspartic proteinases.The journal of biological chemistry. 264: 16748-53.
  • Size / Price
    Catalog: HG10635-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"