CASP8/ALPS2B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10078-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CASP8/ALPS2B Reagents
CRO Services
Product recommended

All CASP8/ALPS2B Reagents
CASP8/ALPS2B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1440 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.48kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CASP8/ALPS2B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CASP8/ALPS2B cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human CASP8/ALPS2B Gene Expression validated Image 16457
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
CASP8/ALPS2B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ALPS2B cDNA ORF Clone, Human;CAP4 cDNA ORF Clone, Human;Casp-8 cDNA ORF Clone, Human;FLICE cDNA ORF Clone, Human;MACH cDNA ORF Clone, Human;MCH5 cDNA ORF Clone, Human
CASP8/ALPS2B Background Information

Caspase 8 is a cysteine dependent endoprotease that plays a key role in the regulation of apoptosis (also referred as programmed cell death), an event which is known to be essential in growth and development of embryo, and maintenance of tissue homeostasis. Caspases are broadly classified as apoptosis or inflammation regulatory caspases based on their role in respective processes. Of those known, caspase - 3, -6, -7, -8 and -9 are categorized as apoptotic caspases, whereas caspase -1, -4, -5 and -12 are grouped as inflammatory caspases. The apoptotic caspases are further classified into initiator caspases (caspase -8 and -9) and effecter caspases (caspase -3, -6 and -7) based on their role in transducing the apoptotic signals emanating at the cell membrane.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
caspase 8, apoptosis-related cysteine peptidase
References
  • Menon U, Raghuram P H, Kannan K, et al. Mutation Analysis of the Dimer Forming Domain of the Caspase 8 Gene in Oral Submucous Fibrosis and Squamous Cell Carcinomas[J]. Asian Pacific journal of cancer prevention: APJCP, 2014, 16(11): 4589-4592.
  • info info
    添加购物车成功! 添加购物车失败!