After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
NCBI RefSeq:NM_001227.3
RefSeq ORF Size:912bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with C terminal Myc tag.
Gene Synonym:CASP7, MCH3, CMH-1, ICE-LAP3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tag on other vectors
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10049-ACG$225
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10049-ACR$225
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10049-ANG$225
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10049-ANR$225
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10049-CF$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10049-CH$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10049-CM$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10049-CY$195
Human Caspase-7 transcript variant alpha Gene cDNA clone plasmidHG10049-M$75
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, Flag tagHG10049-M-F$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10049-NF$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10049-NH$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10049-NM$195
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10049-NY$195
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmidHG10049-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

References
  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Size / Price
    Catalog: HG10049-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"