CASP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10055-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CASP2 Reagents
CRO Services
Product recommended

All CASP2 Reagents
CASP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Human caspase 2, apoptosis-related cysteine peptidase (CASP2), transcript variant 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CASP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CASP-2 cDNA ORF Clone, Human;ICH1 cDNA ORF Clone, Human;NEDD-2 cDNA ORF Clone, Human;NEDD2 cDNA ORF Clone, Human;PPP1R57 cDNA ORF Clone, Human
CASP2 Background Information
Full Name
caspase 2, apoptosis-related cysteine peptidase

CASP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CASP2 cDNA ORF Clone in Cloning Vector, Mouse MG53622-U
CASP2 cDNA ORF Clone, Mouse, untagged MG53622-UT
CASP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53622-ACG
CASP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53622-ACGLN
CASP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53622-ANG
CASP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53622-ACR
CASP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53622-ANR
CASP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53622-CF
CASP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53622-NF
CASP2 cDNA ORF Clone, Mouse, C-His tag MG53622-CH
CASP2 cDNA ORF Clone, Mouse, N-His tag MG53622-NH
CASP2 cDNA ORF Clone, Mouse, C-HA tag MG53622-CY
CASP2 cDNA ORF Clone, Mouse, N-HA tag MG53622-NY
CASP2 cDNA ORF Clone, Mouse, C-Myc tag MG53622-CM
CASP2 cDNA ORF Clone, Mouse, N-Myc tag MG53622-NM

CASP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CASP2 cDNA ORF Clone in Cloning Vector, Human HG10055-M
CASP2 cDNA ORF Clone, Human, untagged HG10055-UT
CASP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10055-ACGLN
CASP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10055-ACG
CASP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10055-ANG
CASP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10055-ACR
CASP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10055-ANR
CASP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10055-CF
CASP2 cDNA ORF Clone, Human, C-His tag HG10055-CH
CASP2 cDNA ORF Clone, Human, N-His tag HG10055-NH
CASP2 cDNA ORF Clone, Human, C-HA tag HG10055-CY
CASP2 cDNA ORF Clone, Human, N-HA tag HG10055-NY
CASP2 cDNA ORF Clone, Human, C-Myc tag HG10055-CM
CASP2 cDNA ORF Clone, Human, N-Myc tag HG10055-NM
CASP2 qPCR Primer Pairs, Human HP100143
info info
添加购物车成功! 添加购物车失败!