Carboxypeptidase M cDNA ORF Clone, Human, untagged

Cat: HG11228-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Carboxypeptidase M Reagents
CRO Services
Product recommended

All Carboxypeptidase M Reagents
Carboxypeptidase M cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 417 T/C and 1077 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human carboxypeptidase M.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.33kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Carboxypeptidase M cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase M cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Carboxypeptidase M Background Information

Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.

Full Name
carboxypeptidase M
References
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
  • Carboxypeptidase M cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase M cDNA ORF Clone in Cloning Vector, Mouse MG50990-G
    Carboxypeptidase M cDNA ORF Clone, Mouse, untagged MG50990-UT
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50990-ACG
    Carboxypeptidase M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50990-ACGLN
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50990-ACR
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50990-CF
    Carboxypeptidase M cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50990-NF
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-His tag MG50990-CH
    Carboxypeptidase M cDNA ORF Clone, Mouse, N-His tag MG50990-NH
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-HA tag MG50990-CY
    Carboxypeptidase M cDNA ORF Clone, Mouse, N-HA tag MG50990-NY
    Carboxypeptidase M cDNA ORF Clone, Mouse, C-Myc tag MG50990-CM
    Carboxypeptidase M cDNA ORF Clone, Mouse, N-Myc tag MG50990-NM
    Carboxypeptidase M qPCR Primer Pairs, Mouse MP200956

    Carboxypeptidase M cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase M cDNA ORF Clone in Cloning Vector, Human HG11228-M
    Carboxypeptidase M Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11228-ACGLN
    Carboxypeptidase M cDNA ORF Clone, Human, C-GFPSpark® tag HG11228-ACG
    Carboxypeptidase M cDNA ORF Clone, Human, C-OFPSpark® tag HG11228-ACR
    Carboxypeptidase M cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11228-CF
    Carboxypeptidase M cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11228-NF
    Carboxypeptidase M cDNA ORF Clone, Human, C-His tag HG11228-CH
    Carboxypeptidase M cDNA ORF Clone, Human, N-His tag HG11228-NH
    Carboxypeptidase M cDNA ORF Clone, Human, C-HA tag HG11228-CY
    Carboxypeptidase M cDNA ORF Clone, Human, N-HA tag HG11228-NY
    Carboxypeptidase M cDNA ORF Clone, Human, C-Myc tag HG11228-CM
    Carboxypeptidase M cDNA ORF Clone, Human, N-Myc tag HG11228-NM
    Carboxypeptidase M qPCR Primer Pairs, Human HP101129
    info info
    添加购物车成功! 添加购物车失败!