Quick Order

Human Carboxypeptidase M/CPM Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human CPM cDNA Clone Product Information
    NCBI RefSeq:NM_198320.3
    RefSeq ORF Size:1332bp
    cDNA Description:Full length Clone DNA of Homo sapiens carboxypeptidase M with N terminal Flag tag.
    Gene Synonym:CPM
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPM qPCR primers for gene expression analysis, HP101129 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.

    References
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
  • Size / Price
    Catalog: HG11228-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"