Cadherin-11 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10065-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cadherin-11 Reagents
CRO Services
Product recommended

All Cadherin-11 Reagents
Cadherin-11 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2391 bp
Description
Full length Clone DNA of Human cadherin 11, type 2, OB-cadherin (osteoblast) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cadherin-11 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CAD11 cDNA ORF Clone, Human;CDHOB cDNA ORF Clone, Human;OB cDNA ORF Clone, Human;OSF-4 cDNA ORF Clone, Human
Cadherin-11 Background Information
Full Name
cadherin 11, type 2, OB-cadherin (osteoblast)

Cadherin-11 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Cadherin-11 cDNA ORF Clone in Cloning Vector, Canine DG70023-G
Cadherin-11 cDNA ORF Clone, Canine, untagged DG70023-UT
Cadherin-11 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70023-ACG
Cadherin-11 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70023-ACGLN
Cadherin-11 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70023-ACR
Cadherin-11 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70023-CF
Cadherin-11 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70023-NF
Cadherin-11 cDNA ORF Clone, Canine, C-His tag DG70023-CH
Cadherin-11 cDNA ORF Clone, Canine, N-His tag DG70023-NH
Cadherin-11 cDNA ORF Clone, Canine, C-HA tag DG70023-CY
Cadherin-11 cDNA ORF Clone, Canine, N-HA tag DG70023-NY
Cadherin-11 cDNA ORF Clone, Canine, C-Myc tag DG70023-CM
Cadherin-11 cDNA ORF Clone, Canine, N-Myc tag DG70023-NM

Cadherin-11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Cadherin-11 cDNA ORF Clone in Cloning Vector, Rhesus CG90143-G
Cadherin-11 cDNA ORF Clone, Rhesus, untagged CG90143-UT
Cadherin-11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90143-ACGLN
Cadherin-11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90143-ACG
Cadherin-11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90143-ACR
Cadherin-11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90143-CF
Cadherin-11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90143-NF
Cadherin-11 cDNA ORF Clone, Rhesus, C-His tag CG90143-CH
Cadherin-11 cDNA ORF Clone, Rhesus, N-His tag CG90143-NH
Cadherin-11 cDNA ORF Clone, Rhesus, C-HA tag CG90143-CY
Cadherin-11 cDNA ORF Clone, Rhesus, N-HA tag CG90143-NY
Cadherin-11 cDNA ORF Clone, Rhesus, C-Myc tag CG90143-CM
Cadherin-11 cDNA ORF Clone, Rhesus, N-Myc tag CG90143-NM

Cadherin-11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cadherin-11 cDNA ORF Clone in Cloning Vector, Mouse MG51164-G
Cadherin-11 cDNA ORF Clone, Mouse, untagged MG51164-UT
Cadherin-11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51164-ACGLN
Cadherin-11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51164-ACG
Cadherin-11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51164-ACR
Cadherin-11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51164-CF
Cadherin-11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51164-NF
Cadherin-11 cDNA ORF Clone, Mouse, C-His tag MG51164-CH
Cadherin-11 cDNA ORF Clone, Mouse, N-His tag MG51164-NH
Cadherin-11 cDNA ORF Clone, Mouse, C-HA tag MG51164-CY
Cadherin-11 cDNA ORF Clone, Mouse, N-HA tag MG51164-NY
Cadherin-11 cDNA ORF Clone, Mouse, C-Myc tag MG51164-CM
Cadherin-11 cDNA ORF Clone, Mouse, N-Myc tag MG51164-NM

Cadherin-11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cadherin-11 cDNA ORF Clone in Cloning Vector, Human HG10065-M
Cadherin-11 cDNA ORF Clone, Human, C-GFPSpark® tag HG10065-ACG
Cadherin-11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10065-ACGLN
Cadherin-11 cDNA ORF Clone, Human, C-OFPSpark® tag HG10065-ACR
Cadherin-11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10065-CF
Cadherin-11 cDNA ORF Clone, Human, C-His tag HG10065-CH
Cadherin-11 cDNA ORF Clone, Human, N-His tag HG10065-NH
Cadherin-11 cDNA ORF Clone, Human, C-HA tag HG10065-CY
Cadherin-11 cDNA ORF Clone, Human, N-HA tag HG10065-NY
Cadherin-11 cDNA ORF Clone, Human, C-Myc tag HG10065-CM
Cadherin-11 cDNA ORF Clone, Human, N-Myc tag HG10065-NM
Cadherin-11 qPCR Primer Pairs, Human HP100151
info info
添加购物车成功! 添加购物车失败!