After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CAMK2A Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CAMK2A cDNA Clone Product Information
NCBI RefSeq:NM_171825.1
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase II alpha with C terminal HA tag.
Gene Synonym:CAMKA, KIAA0968
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Ca2+/calmodulin-dependent protein kinase2A (CAMK2A) belongs to the serine/threonine protein kinase family and, together with other 28 different isoforms, belongs to the Ca2+/ calmodulin-dependent protein kinase subfamily. CaM kinase Ⅱ is thought to be an important mediator of learning and memory and is also necessary for Ca2+ homeostasis and reuptake in cardiomyocytes chloride transport in epithelia, positive T-cell selection, and CD8 T-cell activation. CAMKIIA is one of the major forms of CAMKII. It has been found to play a critical role in sustaining activation of CAMKII at the postsynaptic density. Studies have found that knockout mice without CAMKIIA demonstrate a low frequency of LTP. Additionally, these mice do not form persistent, stable place cells in the hippocampus.

References
  • Lin CR, et al. (1987). Molecular cloning of a brain-specific calcium/calmodulin-dependent protein kinase. Proc Natl Acad Sci U S A. 84 (16): 5962-6.
  • Walikonis RS, et al. (2001) Densin-180 forms a ternary complex with the (alpha)-subunit of Ca2+/calmodulin-dependent protein kinase II and (alpha)-actinin. J Neurosci. 21 (2): 423-33.
  • Gardoni F, et al. (2003) CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction. J Biol Chem. 278 (45): 44745-52.
  • Size / Price
    Catalog: HG10648-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"