CYP2D6/Cytochrome P450 2D6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12022-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CYP2D6/Cytochrome P450 2D6 Reagents
CRO Services
Product recommended

All CYP2D6/Cytochrome P450 2D6 Reagents
CYP2D6/Cytochrome P450 2D6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1494 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cytochrome P450, family 2, subfamily D, polypeptide 6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.54kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CYP2D6/Cytochrome P450 2D6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYP2D6/Cytochrome P450 2D6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CYP2D6/Cytochrome P450 2D6 Gene Expression validated Image 1871
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
CYP2D6/Cytochrome P450 2D6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CPD6 cDNA ORF Clone, Human;CYP2D cDNA ORF Clone, Human;CYP2D7AP cDNA ORF Clone, Human;CYP2D7BP cDNA ORF Clone, Human;CYP2D7P2 cDNA ORF Clone, Human;CYP2D8P2 cDNA ORF Clone, Human;CYP2DL1 cDNA ORF Clone, Human;CYPIID6 cDNA ORF Clone, Human;P450-DB1 cDNA ORF Clone, Human;P450C2D cDNA ORF Clone, Human;P450DB1 cDNA ORF Clone, Human
CYP2D6/Cytochrome P450 2D6 Background Information
Full Name
cytochrome P450 family 2 subfamily D member 6
info info
添加购物车成功! 添加购物车失败!