Quick Order

Human CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CYP2D6 cDNA Clone Product Information
NCBI RefSeq:NM_000106.4
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Gene Synonym:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Restriction Site:KpnI + XbaI (6.1kb + 1.49kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP2D6 qPCR primers for gene expression analysis, HP101558 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12022-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"