Quick Order

Human Cytoglobin / CYGB Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CYGB cDNA Clone Product Information
NCBI RefSeq:BC029798
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Homo sapiens cytoglobin with N terminal Myc tag.
Gene Synonym:HGB, STAP, CYGB
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Cytoglobin, also known as CYGB, is a globin molecule ubiquitously expressed in all tissues and most notably utilized in marine mammals. Its avtual function is still unknown. It is thought to be a method of protection under conditions of hypoxia. The predicted function of cytoglobin is the transfer of oxygen from arterial blood to the brain. Cytoglobin is also present in chondroblasts and osteoblasts and shows a decreased level of expression upon differentiation to chondrocytes and osteocytes. Cytoglobin may facilitate diffusion of oxygen through tissues, scavenge nitric oxide or reactive oxygen species, or serve a protective function during oxidative stress.

References
  • Burmester T. et al., 2002, Mol Biol Evol. 19 (4): 416-21.
  • Trent JT. et al., 2002, J Biol Chem. 277 (22): 19538-45.
  • Kawada N. et al., 2001, J Biol Chem. 276 (27): 25318-23.
  • Schmidt M. et al., 2004, J Biol Chem. 279 (9): 8063-9.
  • Size / Price
    Catalog: HG14367-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"