Quick Order

Human Cytoglobin / CYGB Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CYGB cDNA Clone Product Information
NCBI RefSeq:BC029798
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Homo sapiens cytoglobin with N terminal His tag.
Gene Synonym:HGB, STAP, CYGB
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cytoglobin, also known as CYGB, is a globin molecule ubiquitously expressed in all tissues and most notably utilized in marine mammals. Its avtual function is still unknown. It is thought to be a method of protection under conditions of hypoxia. The predicted function of cytoglobin is the transfer of oxygen from arterial blood to the brain. Cytoglobin is also present in chondroblasts and osteoblasts and shows a decreased level of expression upon differentiation to chondrocytes and osteocytes. Cytoglobin may facilitate diffusion of oxygen through tissues, scavenge nitric oxide or reactive oxygen species, or serve a protective function during oxidative stress.

References
  • Burmester T. et al., 2002, Mol Biol Evol. 19 (4): 416-21.
  • Trent JT. et al., 2002, J Biol Chem. 277 (22): 19538-45.
  • Kawada N. et al., 2001, J Biol Chem. 276 (27): 25318-23.
  • Schmidt M. et al., 2004, J Biol Chem. 279 (9): 8063-9.
  • Size / Price
    Catalog: HG14367-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"