CXCL9 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10888-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CXCL9 Reagents
CRO Services
Product recommended

All CXCL9 Reagents
CXCL9 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
378 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 9 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL9 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CMK cDNA ORF Clone, Human;crg-10 cDNA ORF Clone, Human;Humig cDNA ORF Clone, Human;MIG cDNA ORF Clone, Human;SCYB9 cDNA ORF Clone, Human
CXCL9 Background Information

Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as Monokine induced by gamma interferon (MIG), is a small cytokine belonging to the CXC chemokine family. The function of this chemokine has not been specifically defined; however, it is thought to be involved in T cell trafficking. CXCL9/MIG functions as one of the three ligands of chemokine receptor CXCR3 which is a G protein-coupled receptor found predominantly on T cells. CXCL9/MIG, together with CXCL10 and CXCL11, may activate CXCR3 by binding to it. CXCL9 serves as a cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. It has been observed that tumour endothelial cells secrete high levels of CXCL9 in all, and CXCL10 in most melanoma metastases. Experiment data represent novel mechanisms by which tumour cells in melanoma metastases might use the chemokine-expressing endothelium to leave the tumour and eventually to form additional metastases at distinct sites. Experiment results also improved that CXCL9/MIG plays an important role in CD4+ T lymphocyte recruitment and development of CAV, MOMA-2+ macrophages are the predominant recipient-derived source of CXCL9/MIG, and recipient CD4 lymphocytes are necessary for sustained CXCL9/MIG production and CAV development in this model. Neutralization of the chemokine CXCL9/MIG may have therapeutic potential for the treatment of chronic rejection after heart transplantation.

Full Name
chemokine (C-X-C motif) ligand 9
References
  • Ruehlmann JM, et al. (2001) MIG (CXCL9) chemokine gene therapy combines with antibody-cytokine fusion protein to suppress growth and dissemination of murine colon carcinoma. Cancer Res. 61(23): 8498-503.
  • Belperio JA, et al. (2003) Role of CXCL9/CXCR3 chemokine biology during pathogenesis of acute lung allograft rejection. J Immunol. 171(9): 4844-52.
  • Colvin RA, et al. (2004) Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem. 279(29): 30219-27.
  • Valbuena G, et al. (2003) Expression analysis of the T-cell-targeting chemokines CXCL9 and CXCL10 in mice and humans with endothelial infections caused by rickettsiae of the spotted fever group. Am J Pathol. 163(4): 1357-69.
  • CXCL9 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CXCL9 cDNA ORF Clone in Cloning Vector, Rhesus CG90135-G
    CXCL9 cDNA ORF Clone, Rhesus, untagged CG90135-UT
    CXCL9 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90135-ACG
    CXCL9 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90135-ACGLN
    CXCL9 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90135-ACR
    CXCL9 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90135-CF
    CXCL9 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90135-NF
    CXCL9 cDNA ORF Clone, Rhesus, C-His tag CG90135-CH
    CXCL9 cDNA ORF Clone, Rhesus, N-His tag CG90135-NH
    CXCL9 cDNA ORF Clone, Rhesus, C-HA tag CG90135-CY
    CXCL9 cDNA ORF Clone, Rhesus, N-HA tag CG90135-NY
    CXCL9 cDNA ORF Clone, Rhesus, C-Myc tag CG90135-CM
    CXCL9 cDNA ORF Clone, Rhesus, N-Myc tag CG90135-NM

    CXCL9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL9 cDNA ORF Clone in Cloning Vector, Mouse MG50155-M
    CXCL9 cDNA ORF Clone, Mouse, untagged MG50155-UT
    CXCL9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50155-ACG
    CXCL9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50155-ACGLN
    CXCL9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50155-ACR
    CXCL9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50155-CF
    CXCL9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50155-NF
    CXCL9 cDNA ORF Clone, Mouse, C-His tag MG50155-CH
    CXCL9 cDNA ORF Clone, Mouse, N-His tag MG50155-NH
    CXCL9 cDNA ORF Clone, Mouse, C-HA tag MG50155-CY
    CXCL9 cDNA ORF Clone, Mouse, N-HA tag MG50155-NY
    CXCL9 cDNA ORF Clone, Mouse, C-Myc tag MG50155-CM
    CXCL9 cDNA ORF Clone, Mouse, N-Myc tag MG50155-NM
    CXCL9 qPCR Primer Pairs, Mouse MP200185

    CXCL9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL9 cDNA ORF Clone in Cloning Vector, Human HG10888-M
    CXCL9 cDNA ORF Clone, Human, untagged HG10888-UT
    CXCL9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10888-ACGLN
    CXCL9 cDNA ORF Clone, Human, C-GFPSpark® tag HG10888-ACG
    CXCL9 cDNA ORF Clone, Human, C-OFPSpark® tag HG10888-ACR
    CXCL9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10888-CF
    CXCL9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10888-NF
    CXCL9 cDNA ORF Clone, Human, C-His tag HG10888-CH
    CXCL9 cDNA ORF Clone, Human, N-His tag HG10888-NH
    CXCL9 cDNA ORF Clone, Human, C-HA tag HG10888-CY
    CXCL9 cDNA ORF Clone, Human, N-HA tag HG10888-NY
    CXCL9 cDNA ORF Clone, Human, C-Myc tag HG10888-CM
    CXCL9 qPCR Primer Pairs, Human HP100773
    info info
    添加购物车成功! 添加购物车失败!