CXCL6 / GCP-2 cDNA ORF Clone, Human, C-HA tag

Cat: HG10612-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL6 / GCP-2 Reagents
CRO Services
Product recommended

All CXCL6 / GCP-2 Reagents
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL6 / GCP-2 cDNA ORF Clone, Human, C-HA tag Alternative Names
CKA-3 cDNA ORF Clone, Human;GCP-2 cDNA ORF Clone, Human;GCP2 cDNA ORF Clone, Human;SCYB6 cDNA ORF Clone, Human
CXCL6 / GCP-2 Background Information
Full Name
chemokine (C-X-C motif) ligand 6

CXCL6 / GCP-2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CXCL6 / GCP-2 cDNA ORF Clone in Cloning Vector, Rat RG80059-M
CXCL6 / GCP-2 cDNA ORF Clone, Rat, untagged RG80059-UT
CXCL6 / GCP-2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80059-ACGLN
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80059-ACG
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80059-ACR
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80059-CF
CXCL6 / GCP-2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80059-NF
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-His tag RG80059-CH
CXCL6 / GCP-2 cDNA ORF Clone, Rat, N-His tag RG80059-NH
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-HA tag RG80059-CY
CXCL6 / GCP-2 cDNA ORF Clone, Rat, N-HA tag RG80059-NY
CXCL6 / GCP-2 cDNA ORF Clone, Rat, C-Myc tag RG80059-CM
CXCL6 / GCP-2 cDNA ORF Clone, Rat, N-Myc tag RG80059-NM

CXCL6 / GCP-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CXCL6 / GCP-2 cDNA ORF Clone in Cloning Vector, Human HG10612-M
CXCL6 / GCP-2 cDNA ORF Clone, Human, untagged HG10612-UT
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10612-ACG
CXCL6 / GCP-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10612-ACGLN
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10612-ACR
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10612-CF
CXCL6 / GCP-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10612-NF
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-His tag HG10612-CH
CXCL6 / GCP-2 cDNA ORF Clone, Human, N-His tag HG10612-NH
CXCL6 / GCP-2 cDNA ORF Clone, Human, N-HA tag HG10612-NY
CXCL6 / GCP-2 cDNA ORF Clone, Human, C-Myc tag HG10612-CM
CXCL6 / GCP-2 cDNA ORF Clone, Human, N-Myc tag HG10612-NM
CXCL6 / GCP-2 qPCR Primer Pairs, Human HP100597
info info
添加购物车成功! 添加购物车失败!