CXCL5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10889-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL5 Reagents
CRO Services
Product recommended

All CXCL5 Reagents
CXCL5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
345 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ENA-78 cDNA ORF Clone, Human;SCYB5 cDNA ORF Clone, Human
CXCL5 Background Information

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.

Full Name
chemokine (C-X-C motif) ligand 5
References
  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.
  • CXCL5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CXCL5 cDNA ORF Clone in Cloning Vector, Mouse MG50354-M
    CXCL5 cDNA ORF Clone, Mouse, untagged MG50354-UT
    CXCL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50354-ACGLN
    CXCL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50354-ACG
    CXCL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50354-ACR
    CXCL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50354-CF
    CXCL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50354-NF
    CXCL5 cDNA ORF Clone, Mouse, C-His tag MG50354-CH
    CXCL5 cDNA ORF Clone, Mouse, N-His tag MG50354-NH
    CXCL5 cDNA ORF Clone, Mouse, C-HA tag MG50354-CY
    CXCL5 cDNA ORF Clone, Mouse, N-HA tag MG50354-NY
    CXCL5 cDNA ORF Clone, Mouse, C-Myc tag MG50354-CM
    CXCL5 cDNA ORF Clone, Mouse, N-Myc tag MG50354-NM
    CXCL5 qPCR Primer Pairs, Mouse MP200375

    CXCL5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CXCL5 cDNA ORF Clone in Cloning Vector, Human HG10889-M
    CXCL5 cDNA ORF Clone, Human, untagged HG10889-UT
    CXCL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10889-ACGLN
    CXCL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10889-ACG
    CXCL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10889-ACR
    CXCL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10889-CF
    CXCL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10889-NF
    CXCL5 cDNA ORF Clone, Human, C-His tag HG10889-CH
    CXCL5 cDNA ORF Clone, Human, N-His tag HG10889-NH
    CXCL5 cDNA ORF Clone, Human, C-HA tag HG10889-CY
    CXCL5 cDNA ORF Clone, Human, N-HA tag HG10889-NY
    CXCL5 cDNA ORF Clone, Human, C-Myc tag HG10889-CM
    CXCL5 qPCR Primer Pairs, Human HP100774

    CXCL5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CXCL5 qPCR Primer Pairs, Rat RP300057
    info info
    添加购物车成功! 添加购物车失败!