GRO gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12186-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GRO gamma Reagents
CRO Services
Product recommended

All GRO gamma Reagents
GRO gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRO gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CINC-2b cDNA ORF Clone, Human;CXCL3 cDNA ORF Clone, Human;GRO3 cDNA ORF Clone, Human;GROG cDNA ORF Clone, Human;MIP-2b cDNA ORF Clone, Human;MIP2B cDNA ORF Clone, Human;SCYB3 cDNA ORF Clone, Human
GRO gamma Background Information
Full Name
chemokine (C-X-C motif) ligand 3

GRO gamma cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRO gamma cDNA ORF Clone in Cloning Vector, Mouse MG50258-M
GRO gamma cDNA ORF Clone, Mouse, untagged MG50258-UT
GRO gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50258-ACG
GRO gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50258-ACGLN
GRO gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50258-ACR
GRO gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50258-CF
GRO gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50258-NF
GRO gamma cDNA ORF Clone, Mouse, C-His tag MG50258-CH
GRO gamma cDNA ORF Clone, Mouse, N-His tag MG50258-NH
GRO gamma cDNA ORF Clone, Mouse, C-HA tag MG50258-CY
GRO gamma cDNA ORF Clone, Mouse, N-HA tag MG50258-NY
GRO gamma cDNA ORF Clone, Mouse, C-Myc tag MG50258-CM
GRO gamma cDNA ORF Clone, Mouse, N-Myc tag MG50258-NM
GRO gamma qPCR Primer Pairs, Mouse MP200284

GRO gamma cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRO gamma cDNA ORF Clone in Cloning Vector, Human HG12186-G
GRO gamma cDNA ORF Clone, Human, untagged HG12186-UT
GRO gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12186-ACGLN
GRO gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG12186-ACG
GRO gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG12186-ACR
GRO gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12186-CF
GRO gamma cDNA ORF Clone, Human, C-His tag HG12186-CH
GRO gamma cDNA ORF Clone, Human, N-His tag HG12186-NH
GRO gamma cDNA ORF Clone, Human, C-HA tag HG12186-CY
GRO gamma cDNA ORF Clone, Human, N-HA tag HG12186-NY
GRO gamma cDNA ORF Clone, Human, C-Myc tag HG12186-CM
GRO gamma cDNA ORF Clone, Human, N-Myc tag HG12186-NM
GRO gamma qPCR Primer Pairs, Human HP101840
info info
添加购物车成功! 添加购物车失败!