GRO beta cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10586-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GRO beta Reagents
CRO Services
Product recommended

All GRO beta Reagents
GRO beta cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRO beta cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human CXCL2/MIP-2 Gene Expression validated Image 16629
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
GRO beta cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CINC-2a cDNA ORF Clone, Human;GRO2 cDNA ORF Clone, Human;GROb cDNA ORF Clone, Human;MGSA-b cDNA ORF Clone, Human;MIP-2a cDNA ORF Clone, Human;MIP2 cDNA ORF Clone, Human;MIP2A cDNA ORF Clone, Human;SCYB2 cDNA ORF Clone, Human
GRO beta Background Information

Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

Full Name
chemokine (C-X-C motif) ligand 2
References
  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • GRO beta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GRO beta cDNA ORF Clone in Cloning Vector, Rat RG80042-M
    GRO beta cDNA ORF Clone, Rat, untagged RG80042-UT
    GRO beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80042-ACGLN
    GRO beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80042-ACG
    GRO beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80042-ACR
    GRO beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80042-CF
    GRO beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80042-NF
    GRO beta cDNA ORF Clone, Rat, C-His tag RG80042-CH
    GRO beta cDNA ORF Clone, Rat, N-His tag RG80042-NH
    GRO beta cDNA ORF Clone, Rat, C-HA tag RG80042-CY
    GRO beta cDNA ORF Clone, Rat, N-HA tag RG80042-NY
    GRO beta cDNA ORF Clone, Rat, C-Myc tag RG80042-CM
    GRO beta cDNA ORF Clone, Rat, N-Myc tag RG80042-NM
    GRO beta qPCR Primer Pairs, Rat RP300041

    GRO beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GRO beta cDNA ORF Clone in Cloning Vector, Mouse MG50070-M
    GRO beta cDNA ORF Clone, Mouse, untagged MG50070-UT
    GRO beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50070-ACG
    GRO beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50070-ACGLN
    GRO beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50070-ACR
    GRO beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50070-CF
    GRO beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50070-NF
    GRO beta cDNA ORF Clone, Mouse, C-His tag MG50070-CH
    GRO beta cDNA ORF Clone, Mouse, N-His tag MG50070-NH
    GRO beta cDNA ORF Clone, Mouse, C-HA tag MG50070-CY
    GRO beta cDNA ORF Clone, Mouse, N-HA tag MG50070-NY
    GRO beta cDNA ORF Clone, Mouse, C-Myc tag MG50070-CM
    GRO beta cDNA ORF Clone, Mouse, N-Myc tag MG50070-NM
    GRO beta qPCR Primer Pairs, Mouse MP200101

    GRO beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GRO beta cDNA ORF Clone in Cloning Vector, Human HG10586-M
    GRO beta cDNA ORF Clone, Human, untagged HG10586-UT
    GRO beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10586-ACGLN
    GRO beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10586-ACG
    GRO beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10586-ACR
    GRO beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10586-CF
    GRO beta cDNA ORF Clone, Human, C-His tag HG10586-CH
    GRO beta cDNA ORF Clone, Human, N-His tag HG10586-NH
    GRO beta cDNA ORF Clone, Human, C-HA tag HG10586-CY
    GRO beta cDNA ORF Clone, Human, N-HA tag HG10586-NY
    GRO beta cDNA ORF Clone, Human, C-Myc tag HG10586-CM
    GRO beta cDNA ORF Clone, Human, N-Myc tag HG10586-NM
    GRO beta qPCR Primer Pairs, Human HP100589
    info info
    添加购物车成功! 添加购物车失败!