CXCL14 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10880-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL14 Reagents
CRO Services
Product recommended

All CXCL14 Reagents
CXCL14 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
300 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 14 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL14 cDNA ORF Clone, Human, N-Myc tag Alternative Names
BMAC cDNA ORF Clone, Human;BRAK cDNA ORF Clone, Human;KEC cDNA ORF Clone, Human;KS1 cDNA ORF Clone, Human;MIP-2g cDNA ORF Clone, Human;MIP2G cDNA ORF Clone, Human;NJAC cDNA ORF Clone, Human;SCYB14 cDNA ORF Clone, Human
CXCL14 Background Information
Full Name
chemokine (C-X-C motif) ligand 14

CXCL14 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CXCL14 cDNA ORF Clone in Cloning Vector, Rhesus CG90078-G
CXCL14 cDNA ORF Clone, Rhesus, untagged CG90078-UT
CXCL14 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90078-ACG
CXCL14 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90078-ACGLN
CXCL14 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90078-ACR
CXCL14 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90078-CF
CXCL14 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90078-NF
CXCL14 cDNA ORF Clone, Rhesus, C-His tag CG90078-CH
CXCL14 cDNA ORF Clone, Rhesus, N-His tag CG90078-NH
CXCL14 cDNA ORF Clone, Rhesus, C-HA tag CG90078-CY
CXCL14 cDNA ORF Clone, Rhesus, N-HA tag CG90078-NY
CXCL14 cDNA ORF Clone, Rhesus, C-Myc tag CG90078-CM
CXCL14 cDNA ORF Clone, Rhesus, N-Myc tag CG90078-NM

CXCL14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCL14 cDNA ORF Clone in Cloning Vector, Mouse MG50141-M
CXCL14 cDNA ORF Clone, Mouse, untagged MG50141-UT
CXCL14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50141-ACGLN
CXCL14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50141-ACG
CXCL14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50141-ACR
CXCL14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50141-CF
CXCL14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50141-NF
CXCL14 cDNA ORF Clone, Mouse, C-His tag MG50141-CH
CXCL14 cDNA ORF Clone, Mouse, N-His tag MG50141-NH
CXCL14 cDNA ORF Clone, Mouse, C-HA tag MG50141-CY
CXCL14 cDNA ORF Clone, Mouse, N-HA tag MG50141-NY
CXCL14 cDNA ORF Clone, Mouse, C-Myc tag MG50141-CM
CXCL14 cDNA ORF Clone, Mouse, N-Myc tag MG50141-NM
CXCL14 qPCR Primer Pairs, Mouse MP200171

CXCL14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CXCL14 cDNA ORF Clone in Cloning Vector, Human HG10880-M
CXCL14 cDNA ORF Clone, Human, untagged HG10880-UT
CXCL14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10880-ACGLN
CXCL14 cDNA ORF Clone, Human, C-GFPSpark® tag HG10880-ACG
CXCL14 cDNA ORF Clone, Human, C-OFPSpark® tag HG10880-ACR
CXCL14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10880-CF
CXCL14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10880-NF
CXCL14 cDNA ORF Clone, Human, C-His tag HG10880-CH
CXCL14 cDNA ORF Clone, Human, N-His tag HG10880-NH
CXCL14 cDNA ORF Clone, Human, C-HA tag HG10880-CY
CXCL14 cDNA ORF Clone, Human, N-HA tag HG10880-NY
CXCL14 cDNA ORF Clone, Human, C-Myc tag HG10880-CM
CXCL14 qPCR Primer Pairs, Human HP100766
info info
添加购物车成功! 添加购物车失败!